MirGeneDB

MirGeneDB ID

Isc-Mir-92

Family name MIR-92 (all species)
Seed AUUGCAC
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues
Orthologues Aae-Mir-92-o59  Aae-Mir-92-o60  Aca-Mir-92-P1a  Aca-Mir-92-P1b  Aca-Mir-92-P2a  Aca-Mir-92-P2b  Ami-Mir-92-P1a  Ami-Mir-92-P1c  Ami-Mir-92-P2a  Asu-Mir-92  Bfl-Mir-92-o1  Bfl-Mir-92-o2a  Bfl-Mir-92-o2b  Bfl-Mir-92-o3  Bfl-Mir-92-o4  Bfl-Mir-92-o5  Bfl-Mir-92-o6  Bfl-Mir-92-o7  Bge-Mir-92-o63  Bge-Mir-92-o64  Bge-Mir-92-o65  Bge-Mir-92-o66  Bta-Mir-92-P1a  Bta-Mir-92-P1b  Bta-Mir-92-P1c  Bta-Mir-92-P2a  Bta-Mir-92-P2b  Bta-Mir-92-P2c  Cbr-Mir-92-o67  Cbr-Mir-92-o68  Cel-Mir-92  Cfa-Mir-92-P1a  Cfa-Mir-92-P1b  Cfa-Mir-92-P1c  Cfa-Mir-92-P2a  Cfa-Mir-92-P2b  Cfa-Mir-92-P2c  Cgi-Mir-92-o31  Cgi-Mir-92-o32  Cgi-Mir-92-o33  Cgi-Mir-92-o34  Cin-Mir-92-o69  Cin-Mir-92-o70  Cin-Mir-92-o71  Cin-Mir-92-o72  Cin-Mir-92-o73  Cin-Mir-92-o74  Cin-Mir-92-o75  Cin-Mir-92-o76  Cin-Mir-92-o77  Cin-Mir-92-o78  Cli-Mir-92-P1a  Cli-Mir-92-P1b  Cli-Mir-92-P2a  Cli-Mir-92-P2b  Cpi-Mir-92-P1a  Cpi-Mir-92-P1b  Cpi-Mir-92-P1c  Cpi-Mir-92-P2a  Cpi-Mir-92-P2b  Cpo-Mir-92-P1a  Cpo-Mir-92-P1b  Cpo-Mir-92-P1c  Cpo-Mir-92-P2a  Cpo-Mir-92-P2b  Cpo-Mir-92-P2c  Cte-Mir-92-o35  Cte-Mir-92-o36  Cte-Mir-92-o37  Dan-Mir-92-o14  Dan-Mir-92-o15  Dan-Mir-92-o16  Dan-Mir-92-o17  Dan-Mir-92-o18  Dan-Mir-92-o19  Dme-Mir-92-o14  Dme-Mir-92-o15  Dme-Mir-92-o16  Dme-Mir-92-o17  Dme-Mir-92-o18  Dme-Mir-92-o19  Dmo-Mir-92-o14  Dmo-Mir-92-o15  Dmo-Mir-92-o16  Dmo-Mir-92-o17  Dmo-Mir-92-o19  Dno-Mir-92-P1a  Dno-Mir-92-P1b  Dno-Mir-92-P1c  Dno-Mir-92-P2a  Dno-Mir-92-P2b  Dno-Mir-92-P2c  Dpu-Mir-92-o20  Dpu-Mir-92-o21  Dre-Mir-92-P1a1  Dre-Mir-92-P1a2  Dre-Mir-92-P1c1  Dre-Mir-92-P2b1  Dre-Mir-92-P2c  Efe-Mir-92-o38  Efe-Mir-92-o39  Ete-Mir-92-P1a  Ete-Mir-92-P1b  Ete-Mir-92-P1c  Ete-Mir-92-P2a  Ete-Mir-92-P2b  Ete-Mir-92-P2c  Gga-Mir-92-P1a  Gga-Mir-92-P1b  Gga-Mir-92-P2a  Gga-Mir-92-P2b  Hme-Mir-92-o61  Hme-Mir-92-o62  Hsa-Mir-92-P1a  Hsa-Mir-92-P1b  Hsa-Mir-92-P1c  Hsa-Mir-92-P2a  Hsa-Mir-92-P2b  Hsa-Mir-92-P2c  Lan-Mir-92-o22a  Lan-Mir-92-o22b  Lan-Mir-92-o23a  Lan-Mir-92-o23b  Lan-Mir-92-o24  Lgi-Mir-92-o27-v1  Lgi-Mir-92-o27-v2  Lgi-Mir-92-o28  Lgi-Mir-92-o29  Lgi-Mir-92-o30  Mdo-Mir-92-P1a  Mdo-Mir-92-P1b  Mdo-Mir-92-P1c  Mdo-Mir-92-P2a  Mdo-Mir-92-P2b  Mdo-Mir-92-P2c  Mml-Mir-92-P1a  Mml-Mir-92-P1b  Mml-Mir-92-P1c  Mml-Mir-92-P2a  Mml-Mir-92-P2b  Mml-Mir-92-P2c  Mmu-Mir-92-P1a  Mmu-Mir-92-P1b  Mmu-Mir-92-P1c  Mmu-Mir-92-P2a  Mmu-Mir-92-P2b  Mmu-Mir-92-P2c  Oan-Mir-92-P1a1  Oan-Mir-92-P1a2  Oan-Mir-92-P1a3  Oan-Mir-92-P1a4  Oan-Mir-92-P1b  Oan-Mir-92-P1c  Oan-Mir-92-P2a  Oan-Mir-92-P2b  Oan-Mir-92-P2c  Ocu-Mir-92-P1a  Ocu-Mir-92-P1b  Ocu-Mir-92-P1c  Ocu-Mir-92-P2a  Ocu-Mir-92-P2b  Ocu-Mir-92-P2c  Pfl-Mir-92-o43  Pfl-Mir-92-o44  Pfl-Mir-92-o45  Pfl-Mir-92-o46  Pfl-Mir-92-o47  Pmi-Mir-92-o48  Pmi-Mir-92-o49  Pmi-Mir-92-o50  Pmi-Mir-92-o51  Pmi-Mir-92-o52  Pmi-Mir-92-o53  Pmi-Mir-92-o54  Rno-Mir-92-P1a  Rno-Mir-92-P1b  Rno-Mir-92-P1c  Rno-Mir-92-P2a  Rno-Mir-92-P2b  Rno-Mir-92-P2c  Sha-Mir-92-P1a  Sha-Mir-92-P1b  Sha-Mir-92-P1c  Sha-Mir-92-P2a  Sha-Mir-92-P2b  Sha-Mir-92-P2c  Sko-Mir-92-o8  Sko-Mir-92-o9  Sko-Mir-92-o10  Spu-Mir-92-o11  Spu-Mir-92-o12  Spu-Mir-92-o13  Spu-Mir-92-o55  Spu-Mir-92-o56  Spu-Mir-92-o57  Spu-Mir-92-o58  Sto-Mir-92-P1a  Sto-Mir-92-P1b  Sto-Mir-92-P1c  Sto-Mir-92-P1d  Sto-Mir-92-P2b  Sto-Mir-92-P2d  Tca-Mir-92-o40  Tca-Mir-92-o41  Tca-Mir-92-o42  Tgu-Mir-92-P1a  Tgu-Mir-92-P1b  Tgu-Mir-92-P1c  Tgu-Mir-92-P2a  Tgu-Mir-92-P2b  Xtr-Mir-92-P1a  Xtr-Mir-92-P1b  Xtr-Mir-92-P1c  Xtr-Mir-92-P2a  Xtr-Mir-92-P2b  Xtr-Mir-92-P2c 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS639501: 298034-298092 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
ACGUGCAAAGUUACUCGAUUAGCCUUGGCCAGGUCUGGAUGAGUGCCAAUGUUGCGUAAAUGCUGAAUAUUGCACUCGUCCCGGCCUUUCUCUGGCUUUCUAAGCAACCACUGGAAGCA
Get precursor sequence
Structure
        10        20          30        40        50         
ACGUGCAAAGUUACUCGAUU--|   UU  CC     U          C      GCGUA 
                      AGCC  GG  AGGUC GGAUGAGUGC AAUGUU     A
                      UCGG  UC  UCCGG CCUGCUCACG UUAUAA     A
ACGAAGGUCACCAACGAAUCUU^   UC  UU     C          -      GUCGU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-92_5p*

MirBase accessionNone
Sequence
0- AGGUCUGGAUGAGUGCCAAUGUU -23
Get sequence
Mature sequence

Isc-Mir-92_3p

MirBase accessionNone
Sequence
37- UAUUGCACUCGUCCCGGCCUUU -59
Get sequence