MirGeneDB ID | Bfl-Mir-92-o7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | bfl-mir-2059 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Bfl-Mir-92-o1 Bfl-Mir-92-o2 Bfl-Mir-92-o3 Bfl-Mir-92-o4 Bfl-Mir-92-o5 Bfl-Mir-92-o6 Bfl-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Bla-Mir-92-o7 Cel-Mir-92 Dan-Mir-92-P7 Dme-Mir-92-P7 Dsi-Mir-92-P7 Dya-Mir-92-P7 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049994.1: 4472650-4472707 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AAGGCAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GAUGUGUGAACAUUUGUGUUGGACCCCUUUCAAGGCAAAUUGCUGCAAUACUUUGUAUCCUGCAAGUAUUGCACUUUUUUGCUUUGAAAGGUGUUCUGACAUUUUCAGCGCUCCUGUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GAUGUGUGAACAUUUGU- UG -| C UUGC UUGUA GU G AC CCUUUCAAGGCAAA UGCAAUACU U CA C UG GGAAAGUUUCGUUU ACGUUAUGA C AUGUCCUCGCGACUUUUA GU U^ U UUUC ACGUC 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Bfl-Mir-92-o7_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0019168 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CAAGGCAAAUUGCUGCAAUACU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Bfl-Mir-92-o7_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0009985 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
36- UAUUGCACUUUUUUGCUUUGAA -58
Get sequence
|