| MirGeneDB ID | Bfl-Mir-92-o4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | bfl-mir-92b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Bfl-Mir-92-o1 Bfl-Mir-92-o2 Bfl-Mir-92-o3 Bfl-Mir-92-o5 Bfl-Mir-92-o6 Bfl-Mir-92-o7 Bfl-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aae-Mir-92-P4 Aga-Mir-92-P4 Asu-Mir-92 Bge-Mir-92-P4 Bla-Mir-92-o4 Cel-Mir-92 Dan-Mir-92-P4 Dlo-Mir-92-P4 Dma-Mir-92-P4 Dme-Mir-92-P4 Dmo-Mir-92-P4 Dpu-Mir-92-P4 Dsi-Mir-92-P4 Dya-Mir-92-P4 Esc-Mir-92 Gpa-Mir-92-P4 Gsp-Mir-92 Hme-Mir-92-P4 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 Tca-Mir-92-P4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049981.1: 13639441-13639502 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o4) |
Mir-92-o3
NC_049981.1: 13639020-13639073 [+]
UCSC
Mir-92-o4 NC_049981.1: 13639441-13639502 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CAGGUCGCUCAAGAUACGGCGUUGUUGCUUAGGUCUGGACAGUUGCAAUCUUCGUUCUGUUUCAGCCGAACAUUGCACUCGUCCCGGCCUGAGAAACCGCGCCAAUUUUCAACUCAACUGUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CAGGUCGCUCAAGAUAC-- U G U -| U C CGUUCUG GGCGU GUU CUUAGGUC GGAC AGU GCAAU UU U CCGCG CAA GAGUCCGG CCUG UCA CGUUA AA U GUGUCAACUCAACUUUUAA C A C C^ - C GCCGACU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Bfl-Mir-92-o4_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0019143 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCUGGACAGUUGCAAUCUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Bfl-Mir-92-o4_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0009479 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CAUUGCACUCGUCCCGGCCUGA -62
Get sequence
|
