MirGeneDB ID | Bfl-Mir-92-o6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | bfl-mir-92d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Bfl-Mir-92-o1 Bfl-Mir-92-o2 Bfl-Mir-92-o3 Bfl-Mir-92-o4 Bfl-Mir-92-o5 Bfl-Mir-92-o7 Bfl-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Bla-Mir-92-o6 Cel-Mir-92 Dan-Mir-92-P6 Dme-Mir-92-P6 Dmo-Mir-92-P6 Dsi-Mir-92-P6 Dya-Mir-92-P6a Dya-Mir-92-P6b Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049979.1: 12400557-12400617 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o6) |
Mir-92-o6
NC_049979.1: 12400557-12400617 [-]
UCSC
Mir-92-o5 NC_049979.1: 12400671-12400726 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UUCUAACGCAGCCCUUUCUGUGUGAUUGAUAGGUCAGGAUUGAGUGUUAUGCUGUGAACUUGCUGUCAGUAUUGCACUUAUCCUGGCCUGUCAAUUAUGGCAGCUUCUCACCAGGGUGCAGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 UUCUAACGCAGCCCUUU- -| U U GUGAAC CUG UGUGAUUGAUAGGUCAGGAU GAGUGU AUGCU U GAC GUAUUAACUGUCCGGUCCUA UUCACG UAUGA U GACGUGGGACCACUCUUC G^ - U CUGUCG . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Bfl-Mir-92-o6_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0020079 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGUCAGGAUUGAGUGUUAUGCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Bfl-Mir-92-o6_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
39- UAUUGCACUUAUCCUGGCCUGU -61
Get sequence
|