MirGeneDB ID | Bfl-Mir-92-o5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Bfl-Mir-92-o1 Bfl-Mir-92-o2 Bfl-Mir-92-o3 Bfl-Mir-92-o4 Bfl-Mir-92-o6 Bfl-Mir-92-o7 Bfl-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Bla-Mir-92-o5 Cel-Mir-92 Dan-Mir-92-P5 Dme-Mir-92-P5 Dmo-Mir-92-P5 Dsi-Mir-92-P5 Dya-Mir-92-P5 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049979.1: 12400671-12400726 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o5) |
Mir-92-o6
NC_049979.1: 12400557-12400617 [-]
UCSC
Mir-92-o5 NC_049979.1: 12400671-12400726 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCUC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AGUAUCCUAGCUAUGGUAUAUUUGACUGGUAGGCUGGGAUAAGUUGCAGUACUCUGUAGCCAGUAUUGCUCUUGUUUUGGUCCUGUUGGCUCUGGCAAAUUCUCUGCAGUUCUAACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AGUAUCCUAGCUAUGGUAUAUUU- - GG -|UG UU CUG GA CU UAGG C GGAUAAG GCAGUACU U CU GG GUCC G UUUGUUC CGUUAUGA A CAAUCUUGACGUCUCUUAAACGGU C UU U^GU U- CCG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Bfl-Mir-92-o5_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGCUGGGAUAAGUUGCAGUACU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Bfl-Mir-92-o5_3p (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
33- UAUUGCUCUUGUUUUGGUCCUGU -56
Get sequence
|