MirGeneDB ID | Bfl-Mir-92-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Florida lancelet (Branchiostoma floridae) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | bfl-mir-2063 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Bfl-Mir-92-o1 Bfl-Mir-92-o2 Bfl-Mir-92-o3 Bfl-Mir-92-o4 Bfl-Mir-92-o5 Bfl-Mir-92-o6 Bfl-Mir-92-o7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Bla-Mir-92-o8 Cel-Mir-92 Dan-Mir-92-P8 Dme-Mir-92-P8 Dmo-Mir-92-P8 Dsi-Mir-92-P8 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Branchiostoma | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCF_000003815.2_Bfl_VNyyK_genomic) |
NC_049986.1: 9122708-9122772 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CCGGUAUUCUGGAAUUUGAGGCUCACUUUCAAAAAGCAAAAAGUUGCAAUAUCGGUAUACGACGUUACGUAGAUAUUGCACUAAUUUGCUUUUGAAAGUGGUACCUACCAUUCAUCCAUCUCUUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 CCGGUAUUCUGGAAUUUG- C-| A A- U GGUAUACG AGG UCACUUUCAAAA GCAAA AGU GCAAUAUC A UCC GGUGAAAGUUUU CGUUU UCA CGUUAUAG C UUUCUCUACCUACUUACCA AU^ - AA - AUGCAUUG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Bfl-Mir-92-o8_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AAAAAGCAAAAAGUUGCAAUAUC -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Bfl-Mir-92-o8_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0009989 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
43- UAUUGCACUAAUUUGCUUUUGA -65
Get sequence
|