MirGeneDB

MirGeneDB ID

Aca-Mir-92-P1a

Family name MIR-92 (all species)
Seed AUUGCAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-92a-1
Paralogues Aca-Mir-92-P1b  Aca-Mir-92-P2a  Aca-Mir-92-P2b 
Orthologues Ami-Mir-92-P1a  Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1a  Cel-Mir-92  Cfa-Mir-92-P1a  Cli-Mir-92-P1a  Cpi-Mir-92-P1a  Cpo-Mir-92-P1a  Dno-Mir-92-P1a  Dre-Mir-92-P1a1  Dre-Mir-92-P1a2  Ete-Mir-92-P1a  Gga-Mir-92-P1a  Hsa-Mir-92-P1a  Isc-Mir-92  Mdo-Mir-92-P1a  Mml-Mir-92-P1a  Mmu-Mir-92-P1a  Oan-Mir-92-P1a1  Oan-Mir-92-P1a2  Oan-Mir-92-P1a3  Oan-Mir-92-P1a4  Ocu-Mir-92-P1a  Rno-Mir-92-P1a  Sha-Mir-92-P1a  Sto-Mir-92-P1a  Tgu-Mir-92-P1a  Xtr-Mir-92-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343584.1: 108950-109010 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1a)
Mir-17-P1a GL343584.1: 108268-108328 [+] UCSC Ensembl
Mir-19-P1 GL343584.1: 108539-108596 [+] UCSC Ensembl
Mir-17-P3a GL343584.1: 108699-108757 [+] UCSC Ensembl
Mir-19-P2a GL343584.1: 108837-108897 [+] UCSC Ensembl
Mir-92-P1a GL343584.1: 108950-109010 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAAUUUGAUAAAUUGUACCCCUUUCUACACAGGUUGGGAUUGGUUGCAAUGCUGUCUAUGUGUAUGUGGUAUUGCACUUGUCCCGGCCUGUUGAGGUUGGUGGGUCUAGAACCUGGAAGAA
Get precursor sequence
Structure
        10          20        30        40        50        60
AAAUUUGAUAAAUUGUA-  -| UU   AC            U   U        GUCUAU 
                  CC CC  UCU  ACAGGUUGGGAU GGU GCAAUGCU      G
                  GG GG  GGA  UGUCCGGCCCUG UCA CGUUAUGG      U
AAGAAGGUCCAAGAUCUG  U^ UU   GU            U   -        UGUAUG 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-92-P1a_5p*

MirBase accessionNone
Sequence
0- AGGUUGGGAUUGGUUGCAAUGCU -23
Get sequence
Mature sequence

Aca-Mir-92-P1a_3p

MirBase accessionMIMAT0021993
Sequence
39- UAUUGCACUUGUCCCGGCCUGU -61
Get sequence