MirGeneDB

MirGeneDB ID

Mmu-Mir-92-P1a

Family name MIR-92 (all species)
Seed AUUGCAC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-92a-1
Paralogues Mmu-Mir-92-P1b  Mmu-Mir-92-P1c  Mmu-Mir-92-P2a  Mmu-Mir-92-P2b  Mmu-Mir-92-P2c 
Orthologues Aca-Mir-92-P1a  Ami-Mir-92-P1a  Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1a  Cel-Mir-92  Cfa-Mir-92-P1a  Cli-Mir-92-P1a  Cpi-Mir-92-P1a  Cpo-Mir-92-P1a  Dno-Mir-92-P1a  Dre-Mir-92-P1a1  Dre-Mir-92-P1a2  Ete-Mir-92-P1a  Gga-Mir-92-P1a  Hsa-Mir-92-P1a  Isc-Mir-92  Mdo-Mir-92-P1a  Mml-Mir-92-P1a  Oan-Mir-92-P1a1  Oan-Mir-92-P1a2  Oan-Mir-92-P1a3  Oan-Mir-92-P1a4  Ocu-Mir-92-P1a  Rno-Mir-92-P1a  Sha-Mir-92-P1a  Sto-Mir-92-P1a  Tgu-Mir-92-P1a  Xtr-Mir-92-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr14: 115044437-115044497 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1a)
Mir-17-P1a chr14: 115043684-115043743 [+] UCSC Ensembl
Mir-17-P2a chr14: 115043867-115043930 [+] UCSC Ensembl
Mir-19-P1 chr14: 115044013-115044070 [+] UCSC Ensembl
Mir-17-P3a chr14: 115044183-115044241 [+] UCSC Ensembl
Mir-19-P2a chr14: 115044320-115044380 [+] UCSC Ensembl
Mir-92-P1a chr14: 115044437-115044497 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUAAGGGAAAAUCAAACCCCUUUCUACACAGGUUGGGAUUUGUCGCAAUGCUGUGUUUCUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGGUGGGGAUUGUGACCAGAAGAU
Get precursor sequence
Structure
        10          20        30        40        50        60
AGUAAGGGAAAAUCAAA-  -| UUU  AC            UU  C        GUGUUU 
                  CC CC   CU  ACAGGUUGGGAU  GU GCAAUGCU      C
                  GG GG   GA  UGUCCGGCCCUG  CA CGUUAUGG      U
UAGAAGACCAGUGUUAGG  U^ UUU  GU            UU  -        UAUGUC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-92-P1a_5p*

MirBase accessionMIMAT0017066
Sequence
0- AGGUUGGGAUUUGUCGCAAUGCU -23
Get sequence
Validated targets TargetScanVert: mmu-miR-92a-1-5p
miRDB: MIMAT0017066
Mature sequence

Mmu-Mir-92-P1a_3p

MirBase accessionMIMAT0000539
Sequence
39- UAUUGCACUUGUCCCGGCCUGU -61
Get sequence
Validated targets microrna.org: MIMAT0000539
TargetScanVert: mmu-miR-92a-3p
miRDB: MIMAT0000539