MirGeneDB

MirGeneDB ID

Mmu-Mir-19-P2a

Family name MIR-19 (all species)
Seed GUGCAAA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-19b-1
Paralogues Mmu-Mir-19-P1  Mmu-Mir-19-P2b 
Orthologues Aca-Mir-19-P2a  Ami-Mir-19-P2a  Bta-Mir-19-P2a  Cfa-Mir-19-P2a  Cli-Mir-19-P2a  Cpi-Mir-19-P2a  Cpo-Mir-19-P2a  Dno-Mir-19-P2a  Dre-Mir-19-P2a1  Ete-Mir-19-P2a  Gga-Mir-19-P2a  Hsa-Mir-19-P2a  Mdo-Mir-19-P2a  Mml-Mir-19-P2a  Oan-Mir-19-P2a1  Oan-Mir-19-P2a2  Ocu-Mir-19-P2a  Rno-Mir-19-P2a  Sha-Mir-19-P2a  Sto-Mir-19-P2a  Tgu-Mir-19-P2a  Xtr-Mir-19-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr14: 115044320-115044380 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2a)
Mir-17-P1a chr14: 115043684-115043743 [+] UCSC Ensembl
Mir-17-P2a chr14: 115043867-115043930 [+] UCSC Ensembl
Mir-19-P1 chr14: 115044013-115044070 [+] UCSC Ensembl
Mir-17-P3a chr14: 115044183-115044241 [+] UCSC Ensembl
Mir-19-P2a chr14: 115044320-115044380 [+] UCSC Ensembl
Mir-92-P1a chr14: 115044437-115044497 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUCCUGUUAUUGAGCACUGGUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUAAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUGGUGAAAAGUCUGUAGAGAAGUA
Get precursor sequence
Structure
        10        20          30         40         50          
UGUCCUGUUAUUGAGCACUGGU--                 -  -|     UC    UGUAUA 
                        CUAUGGUUAGUUUUGCA GG UUUGCA  CAGC      \
                        GGUGUCAGUCAAAACGU CC AAACGU  GUCG      A
AUGAAGAGAUGUCUGAAAAGUGGU                 A  U^     --    UCUUAU 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-19-P2a_5p*

MirBase accessionMIMAT0017065
Sequence
0- AGUUUUGCAGGUUUGCAUCCAGC -23
Get sequence
Validated targets TargetScanVert: mmu-miR-19b-1-5p
miRDB: MIMAT0017065
Mature sequence

Mmu-Mir-19-P2a_3p

MirBase accessionMIMAT0000513
Sequence
38- UGUGCAAAUCCAUGCAAAACUGA -61
Get sequence
Validated targets microrna.org: MIMAT0000513
TargetScanVert: mmu-miR-19b-3p
miRDB: MIMAT0000513