MirGeneDB

MirGeneDB ID

Cli-Mir-19-P2a

Family name MIR-19 (all species)
Seed GUGCAAA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-19b-1
Paralogues Cli-Mir-19-P1  Cli-Mir-19-P2b 
Orthologues Aca-Mir-19-P2a  Ami-Mir-19-P2a  Bta-Mir-19-P2a  Cfa-Mir-19-P2a  Cpi-Mir-19-P2a  Cpo-Mir-19-P2a  Dno-Mir-19-P2a  Dre-Mir-19-P2a1  Ete-Mir-19-P2a  Gga-Mir-19-P2a  Hsa-Mir-19-P2a  Mdo-Mir-19-P2a  Mml-Mir-19-P2a  Mmu-Mir-19-P2a  Oan-Mir-19-P2a1  Oan-Mir-19-P2a2  Ocu-Mir-19-P2a  Rno-Mir-19-P2a  Sha-Mir-19-P2a  Sto-Mir-19-P2a  Tgu-Mir-19-P2a  Xtr-Mir-19-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold183: 2837370-2837430 [-]
Clustered MiRNAs
(< 10kb from Mir-19-P2a)
Mir-92-P1a scaffold183: 2837255-2837313 [-]
Mir-19-P2a scaffold183: 2837370-2837430 [-]
Mir-17-P3a scaffold183: 2837507-2837565 [-]
Mir-19-P1 scaffold183: 2837681-2837738 [-]
Mir-17-P2a scaffold183: 2837821-2837884 [-]
Mir-17-P1a scaffold183: 2837971-2838031 [-]
Precursor
(pre-Mir +30nt flank)
UGUUGUUUAAUUGAACACUGUUCUCUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUGAUACUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGCAGUGACAAGUCAGUCAGUGAGUG
Get precursor sequence
Structure
        10            20        30         40         50          
UGUUGUUUAAUUGAACA----|    CUC              -  -      UC    UGUAUG 
                     CUGUU   UGGUUAGUUUUGCA GG UUUGCA  CAGC      \
                     GACGG   GUCAGUCAAAACGU CC AAACGU  GUCG      A
GUGAGUGACUGACUGAACAGU^    U--              A  U      --    UCUCAU 
 .       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-19-P2a_5p*

MirBase accessionMIMAT0038429
Sequence
0- AGUUUUGCAGGUUUGCAUCCAGC -23
Get sequence
Mature sequence

Cli-Mir-19-P2a_3p

MirBase accessionMIMAT0038430
Sequence
38- UGUGCAAAUCCAUGCAAAACUGA -61
Get sequence