MirGeneDB

MirGeneDB ID

Cli-Mir-17-P2a

Family name MIR-17 (all species)
Seed AAGGUGC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-18a
Paralogues Cli-Mir-17-P1a  Cli-Mir-17-P1b  Cli-Mir-17-P2b  Cli-Mir-17-P3a  Cli-Mir-17-P3b 
Orthologues Aca-Mir-17-P2a  Ami-Mir-17-P2a  Bta-Mir-17-P2a  Cfa-Mir-17-P2a  Cpi-Mir-17-P2a  Cpo-Mir-17-P2a  Dno-Mir-17-P2a  Dre-Mir-17-P2a1  Dre-Mir-17-P2a2  Ete-Mir-17-P2a  Gga-Mir-17-P2a  Hsa-Mir-17-P2a  Mdo-Mir-17-P2a  Mml-Mir-17-P2a  Mmu-Mir-17-P2a  Oan-Mir-17-P2a  Ocu-Mir-17-P2a  Rno-Mir-17-P2a  Sha-Mir-17-P2a  Sto-Mir-17-P2a  Tgu-Mir-17-P2a  Xtr-Mir-17-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold183: 2837821-2837884 [-]
Clustered MiRNAs
(< 10kb from Mir-17-P2a)
Mir-92-P1a scaffold183: 2837255-2837313 [-]
Mir-19-P2a scaffold183: 2837370-2837430 [-]
Mir-17-P3a scaffold183: 2837507-2837565 [-]
Mir-19-P1 scaffold183: 2837681-2837738 [-]
Mir-17-P2a scaffold183: 2837821-2837884 [-]
Mir-17-P1a scaffold183: 2837971-2838031 [-]
Precursor
(pre-Mir +30nt flank)
CAGUGUGGUGGUGUGAAGUGCUUUUUGUACUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUAUGUCUUCAUCCAGUCACU
Get precursor sequence
Structure
        10         20        30          40        50        60 
CAGUGUGGUGGUGUGAAGU-         A   --|  U   UC   U    A   UGAAGUA 
                    GCUUUUUGU CUA  AGG GCA  UAG GCAG UAG       G
                    UGAAGAAUA GGU  UCC CGU  AUC CGUC AUC       A
UCACUGACCUACUUCUGUAU         C   CU^  U   GA   C    -   UACGAUU 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-17-P2a_5p

MirBase accessionMIMAT0038423
Sequence
0- UAAGGUGCAUCUAGUGCAGAUAG -23
Get sequence
Star sequence

Cli-Mir-17-P2a_3p*

MirBase accessionMIMAT0038424
Sequence
41- ACUGCCCUAAGUGCUCCUUCUGG -64
Get sequence