MirGeneDB

MirGeneDB ID

Aca-Mir-17-P2a

Family name MIR-17 (all species)
Seed AAGGUGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-17-P1a  Aca-Mir-17-P1b  Aca-Mir-17-P2b  Aca-Mir-17-P3a  Aca-Mir-17-P3b 
Orthologues Ami-Mir-17-P2a  Bta-Mir-17-P2a  Cfa-Mir-17-P2a  Cli-Mir-17-P2a  Cpi-Mir-17-P2a  Cpo-Mir-17-P2a  Dno-Mir-17-P2a  Dre-Mir-17-P2a1  Dre-Mir-17-P2a2  Ete-Mir-17-P2a  Gga-Mir-17-P2a  Hsa-Mir-17-P2a  Mdo-Mir-17-P2a  Mml-Mir-17-P2a  Mmu-Mir-17-P2a  Oan-Mir-17-P2a  Ocu-Mir-17-P2a  Rno-Mir-17-P2a  Sha-Mir-17-P2a  Sto-Mir-17-P2a  Tgu-Mir-17-P2a  Xtr-Mir-17-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343584.1: 108405-108468 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P2a)
Mir-17-P1a GL343584.1: 108268-108328 [+] UCSC Ensembl
Mir-19-P1 GL343584.1: 108539-108596 [+] UCSC Ensembl
Mir-17-P3a GL343584.1: 108699-108757 [+] UCSC Ensembl
Mir-19-P2a GL343584.1: 108837-108897 [+] UCSC Ensembl
Mir-92-P1a GL343584.1: 108950-109010 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCUCCUGCAUAGUGACUGCUUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGAAGUUGUGUUUUCACCCAAUCGCU
Get precursor sequence
Structure
        10         20        30          40        50        60 
CCUCUCCUGCAUAGUGA- U         U   --|  U   UC   U    A   UGAAGUA 
                  C GCUUUUUGU CUA  AGG GCA  UAG GCAG UAG       G
                  G UGAAGAAUA GGU  UCC CGU  AUC CGUC AUC       A
UCGCUAACCCACUUUUGU U         C   CU^  U   GA   C    -   UACGAUU 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-17-P2a_5p

MirBase accessionNone
Sequence
0- UAAGGUGCAUCUAGUGCAGAUAG -23
Get sequence
Star sequence

Aca-Mir-17-P2a_3p*

MirBase accessionNone
Sequence
41- ACUGCCCUAAGUGCUCCUUCUGG -64
Get sequence