MirGeneDB

MirGeneDB ID

Sto-Mir-17-P2a

Family name MIR-17 (all species)
Seed AAGGUGC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-17-P1a  Sto-Mir-17-P1d  Sto-Mir-17-P2b  Sto-Mir-17-P3a  Sto-Mir-17-P3c  Sto-Mir-17-P3d 
Orthologues Aca-Mir-17-P2a  Ami-Mir-17-P2a  Bta-Mir-17-P2a  Cfa-Mir-17-P2a  Cli-Mir-17-P2a  Cpi-Mir-17-P2a  Cpo-Mir-17-P2a  Dno-Mir-17-P2a  Dre-Mir-17-P2a1  Dre-Mir-17-P2a2  Ete-Mir-17-P2a  Gga-Mir-17-P2a  Hsa-Mir-17-P2a  Mdo-Mir-17-P2a  Mml-Mir-17-P2a  Mmu-Mir-17-P2a  Oan-Mir-17-P2a  Ocu-Mir-17-P2a  Rno-Mir-17-P2a  Sha-Mir-17-P2a  Tgu-Mir-17-P2a  Xtr-Mir-17-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01005422.1: 25568-25632 [-]
Precursor
(pre-Mir +30nt flank)
CGCUUGACUUCUUAGUAAAGUCUCUUGUGUUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAGUAGAAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGUAACUCUGAUCAGCUUUGGUGUGCC
Get precursor sequence
Structure
        10          20        30          40        50        60 
CGCUUGACUUCUUAGUAA--   CU         --|  U   UC   U    A   UGAAGUA 
                    AGU  CUUGUGUUA  AGG GCA  UAG GCAG UAG       G
                    UCA  GAAUACGGU  UCC CGU  AUC CGUC AUC       A
CCGUGUGGUUUCGACUAGUC   AU         CU^  U   GA   C    -   UAAGAUG 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-17-P2a_5p

MirBase accessionNone
Sequence
0- UAAGGUGCAUCUAGUGCAGAUAG -23
Get sequence
Star sequence

Sto-Mir-17-P2a_3p*

MirBase accessionNone
Sequence
41- ACUGCCCUAAGUGCUCCUUCUGGC -65
Get sequence