MirGeneDB

MirGeneDB ID

Aca-Mir-19-P2a

Family name MIR-19 (all species)
Seed GUGCAAA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-19b
Paralogues Aca-Mir-19-P1  Aca-Mir-19-P2b 
Orthologues Ami-Mir-19-P2a  Bta-Mir-19-P2a  Cfa-Mir-19-P2a  Cli-Mir-19-P2a  Cpi-Mir-19-P2a  Cpo-Mir-19-P2a  Dno-Mir-19-P2a  Dre-Mir-19-P2a1  Ete-Mir-19-P2a  Gga-Mir-19-P2a  Hsa-Mir-19-P2a  Mdo-Mir-19-P2a  Mml-Mir-19-P2a  Mmu-Mir-19-P2a  Oan-Mir-19-P2a1  Oan-Mir-19-P2a2  Ocu-Mir-19-P2a  Rno-Mir-19-P2a  Sha-Mir-19-P2a  Sto-Mir-19-P2a  Tgu-Mir-19-P2a  Xtr-Mir-19-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343584.1: 108837-108897 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2a)
Mir-17-P1a GL343584.1: 108268-108328 [+] UCSC Ensembl
Mir-19-P1 GL343584.1: 108539-108596 [+] UCSC Ensembl
Mir-17-P3a GL343584.1: 108699-108757 [+] UCSC Ensembl
Mir-19-P2a GL343584.1: 108837-108897 [+] UCSC Ensembl
Mir-92-P1a GL343584.1: 108950-109010 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAUGUCAGUUGAGCACUGUUCUCUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUAUAAUGUGUUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGCAGUGAAAUUCAAUGAAAAUUUGA
Get precursor sequence
Structure
        10            20        30         40         50          
UUCAUGUCAGUUGAGCA----|    CUC              -  -      UC    UGUAUA 
                     CUGUU   UGGUUAGUUUUGCA GG UUUGCA  CAGC      \
                     GACGG   GUCAGUCAAAACGU CC AAACGU  GUCG      A
AGUUUAAAAGUAACUUAAAGU^    U--              A  U      --    UUGUGU 
 .       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-19-P2a_5p*

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUUUGCAUCCAGC -23
Get sequence
Mature sequence

Aca-Mir-19-P2a_3p

MirBase accessionMIMAT0021838
Sequence
38- UGUGCAAAUCCAUGCAAAACUGA -61
Get sequence