MirGeneDB

MirGeneDB ID

Dno-Mir-19-P2a

Family name MIR-19 (all species)
Seed GUGCAAA
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-19b-1
Paralogues Dno-Mir-19-P1  Dno-Mir-19-P2b 
Orthologues Aca-Mir-19-P2a  Ami-Mir-19-P2a  Bta-Mir-19-P2a  Cfa-Mir-19-P2a  Cli-Mir-19-P2a  Cpi-Mir-19-P2a  Cpo-Mir-19-P2a  Dre-Mir-19-P2a1  Ete-Mir-19-P2a  Gga-Mir-19-P2a  Hsa-Mir-19-P2a  Mdo-Mir-19-P2a  Mml-Mir-19-P2a  Mmu-Mir-19-P2a  Oan-Mir-19-P2a1  Oan-Mir-19-P2a2  Ocu-Mir-19-P2a  Rno-Mir-19-P2a  Sha-Mir-19-P2a  Sto-Mir-19-P2a  Tgu-Mir-19-P2a  Xtr-Mir-19-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH570327: 92928-92988 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2a)
Mir-17-P1a JH570327: 92325-92384 [+] UCSC Ensembl
Mir-17-P2a JH570327: 92464-92527 [+] UCSC Ensembl
Mir-19-P1 JH570327: 92615-92672 [+] UCSC Ensembl
Mir-17-P3a JH570327: 92793-92851 [+] UCSC Ensembl
Mir-19-P2a JH570327: 92928-92988 [+] UCSC Ensembl
Mir-92-P1a JH570327: 93045-93103 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUCCUAUUACUGAGCACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAAAUCCAUGCAAAACUGACUGUGGUAGUGAAAAGUCUGUAGAAAAGUA
Get precursor sequence
Structure
        10            20        30         40         50          
UGUCCUAUUACUGAGCA----|  UU                 -  -      UC    UGUGUG 
                     CUG  CUAUGGUUAGUUUUGCA GG UUUGCA  CAGC      \
                     GAU  GGUGUCAGUCAAAACGU CC AAACGU  GUCG      A
AUGAAAAGAUGUCUGAAAAGU^  --                 A  U      --    UCUUAU 
 .       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Dno-Mir-19-P2a_5p* (predicted)

MirBase accessionMIMAT0047517
Sequence
0- AGUUUUGCAGGUUUGCAUCCAGC -23
Get sequence
Mature sequence

Dno-Mir-19-P2a_3p

MirBase accessionMIMAT0047518
Sequence
38- UGUGCAAAUCCAUGCAAAACUGA -61
Get sequence