MirGeneDB

MirGeneDB ID

Mmu-Mir-92-P2a

Family name MIR-92 (all species)
Seed AUUGCAC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-367
Paralogues Mmu-Mir-92-P1a  Mmu-Mir-92-P1b  Mmu-Mir-92-P1c  Mmu-Mir-92-P2b  Mmu-Mir-92-P2c 
Orthologues Aca-Mir-92-P2a  Ami-Mir-92-P2a  Asu-Mir-92  Bfl-Mir-92-o2a  Bta-Mir-92-P2a  Cel-Mir-92  Cfa-Mir-92-P2a  Cli-Mir-92-P2a  Cpi-Mir-92-P2a  Cpo-Mir-92-P2a  Dno-Mir-92-P2a  Ete-Mir-92-P2a  Gga-Mir-92-P2a  Hsa-Mir-92-P2a  Isc-Mir-92  Mdo-Mir-92-P2a  Mml-Mir-92-P2a  Oan-Mir-92-P2a  Ocu-Mir-92-P2a  Rno-Mir-92-P2a  Sha-Mir-92-P2a  Tgu-Mir-92-P2a  Xtr-Mir-92-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr3: 127545741-127545800 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P2a)
Mir-430-P2 chr3: 127545238-127545297 [+] UCSC Ensembl
Mir-430-P3 chr3: 127545368-127545427 [+] UCSC Ensembl
Mir-430-P1 chr3: 127545501-127545561 [+] UCSC Ensembl
Mir-430-P4 chr3: 127545629-127545687 [+] UCSC Ensembl
Mir-92-P2a chr3: 127545741-127545800 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGCUGCAUAUAGAUAGACCAAGGCCGUCACUGUUGCUAACAUGCAACUCUGUUGAAUAGAAAUUGGAAUUGCACUUUAGCAAUGGUGAUGGACCUGUGUCAGUGGCCACUUACUUGGA
Get precursor sequence
Structure
        10         20         30        40        50         
UGUGCUGCAUAUAGAUA-   CA   -|               CA     C   GUUGAA 
                  GAC  AGG CCGUCACUGUUGCUAA  UGCAA UCU      U
                  CUG  UCC GGUAGUGGUAACGAUU  ACGUU AGG      A
AGGUUCAUUCACCGGUGA   UG   A^               UC     A   UUAAAG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-92-P2a_5p*

MirBase accessionMIMAT0017214
Sequence
0- ACUGUUGCUAACAUGCAACUCU -22
Get sequence
Validated targets TargetScanVert: mmu-miR-367-5p
miRDB: MIMAT0017214
Mature sequence

Mmu-Mir-92-P2a_3p

MirBase accessionMIMAT0003181
Sequence
38- AAUUGCACUUUAGCAAUGGUGA -60
Get sequence
Validated targets microrna.org: MIMAT0003181
TargetScanVert: mmu-miR-367-3p
miRDB: MIMAT0003181