MirGeneDB

MirGeneDB ID

Cli-Mir-92-P2a

Family name MIR-92 (all species)
Seed AUUGCAC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-367
Paralogues Cli-Mir-92-P1a  Cli-Mir-92-P1b  Cli-Mir-92-P2b 
Orthologues Aca-Mir-92-P2a  Ami-Mir-92-P2a  Asu-Mir-92  Bfl-Mir-92-o2a  Bta-Mir-92-P2a  Cel-Mir-92  Cfa-Mir-92-P2a  Cpi-Mir-92-P2a  Cpo-Mir-92-P2a  Dno-Mir-92-P2a  Ete-Mir-92-P2a  Gga-Mir-92-P2a  Hsa-Mir-92-P2a  Isc-Mir-92  Mdo-Mir-92-P2a  Mml-Mir-92-P2a  Mmu-Mir-92-P2a  Oan-Mir-92-P2a  Ocu-Mir-92-P2a  Rno-Mir-92-P2a  Sha-Mir-92-P2a  Tgu-Mir-92-P2a  Xtr-Mir-92-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold942: 1626979-1627038 [+]
Clustered MiRNAs
(< 10kb from Mir-92-P2a)
Mir-430-P2 scaffold942: 1626026-1626086 [+]
Mir-430-P3 scaffold942: 1626310-1626366 [+]
Mir-430-P1 scaffold942: 1626451-1626510 [+]
Mir-430-P4 scaffold942: 1626806-1626867 [+]
Mir-92-P2a scaffold942: 1626979-1627038 [+]
Precursor
(pre-Mir +30nt flank)
UAAUGAAAACUCUUUCAACUACAGGCUAAUACUGUUGCUAAUAUGCAACUCUGUUGUAUAAAAAUUGGAAUUGCACUUUAGCAAUGGUGAUGGACUGUCAGACAUGCAAAGAUGUGUAAG
Get precursor sequence
Structure
        10         20         30        40        50         
UAAUGAAAACUCUUUCAA-  -|   G   A            UA     C   GUUGUA 
                   CU ACAG CUA UACUGUUGCUAA  UGCAA UCU      U
                   GA UGUC GGU GUGGUAACGAUU  ACGUU AGG      A
GAAUGUGUAGAAACGUACA  C^   A   A            UC     A   UUAAAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Star sequence

Cli-Mir-92-P2a_5p* (predicted)

MirBase accessionNone
Sequence
0- ACUGUUGCUAAUAUGCAACUCU -22
Get sequence
Mature sequence

Cli-Mir-92-P2a_3p (predicted)

MirBase accessionMIMAT0038627
Sequence
38- AAUUGCACUUUAGCAAUGGUGA -60
Get sequence