MirGeneDB

MirGeneDB ID

Cli-Mir-430-P2

Family name MIR-430 (all species)
Seed AAGUGCU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-302b-1
Paralogues Cli-Mir-430-P1  Cli-Mir-430-P3  Cli-Mir-430-P4 
Orthologues Aca-Mir-430-P2  Ami-Mir-430-P2  Bta-Mir-430-P2  Cfa-Mir-430-P2  Cpi-Mir-430-P2  Cpo-Mir-430-P2  Dno-Mir-430-P2  Dre-Mir-430-o2a1  Dre-Mir-430-o2a2  Dre-Mir-430-o2a3  Dre-Mir-430-o2a4  Dre-Mir-430-o2a5  Dre-Mir-430-o2a6  Dre-Mir-430-o2a7  Dre-Mir-430-o2a8  Dre-Mir-430-o2a9  Dre-Mir-430-o2a10  Dre-Mir-430-o2a11  Dre-Mir-430-o2a12  Dre-Mir-430-o2a13  Dre-Mir-430-o2a14  Dre-Mir-430-o2b  Dre-Mir-430-o2c1  Dre-Mir-430-o2c2  Dre-Mir-430-o2c3  Dre-Mir-430-o2d1  Dre-Mir-430-o2d2  Ete-Mir-430-P2  Gga-Mir-430-P2  Hsa-Mir-430-P2  Mdo-Mir-430-P2  Mml-Mir-430-P2  Mmu-Mir-430-P2  Oan-Mir-430-P2  Ocu-Mir-430-P2  Rno-Mir-430-P2  Sha-Mir-430-P2  Tgu-Mir-430-P2  Xtr-Mir-430-P2 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold942: 1626026-1626086 [+]
Clustered MiRNAs
(< 10kb from Mir-430-P2)
Mir-430-P2 scaffold942: 1626026-1626086 [+]
Mir-430-P3 scaffold942: 1626310-1626366 [+]
Mir-430-P1 scaffold942: 1626451-1626510 [+]
Mir-430-P4 scaffold942: 1626806-1626867 [+]
Mir-92-P2a scaffold942: 1626979-1627038 [+]
Precursor
(pre-Mir +30nt flank)
UAUAACUACAAUUUUUUGUGGACCCCUUUUACUUUAACAUGGAGGUGCUUUCUGUGACUUAAAAGAAGUAAGUGCUUCCAUGUUUUAGUAGAGGUGAAUCCUGAUCACAAUACUGAAAUAC
Get precursor sequence
Structure
        10         20         30        40        50          
UAUAACUACAAUUUUUUGU-   CCC-|       UU          UG   U  GUGACU 
                    GGA    CUUUUACU  AACAUGGAGG  CUU CU      \
                    CCU    GGAGAUGA  UUGUACCUUC  GAA GA      U
CAUAAAGUCAUAACACUAGU   AAGU^       UU          GU   U  AGAAAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), UGUG in loop
Tissue expression
 +
To
Star sequence

Cli-Mir-430-P2_5p* (predicted)

MirBase accessionNone
Sequence
0- ACUUUAACAUGGAGGUGCUUUCU -23
Get sequence
Mature sequence

Cli-Mir-430-P2_3p (predicted)

MirBase accessionMIMAT0038616
Sequence
38- UAAGUGCUUCCAUGUUUUAGUAG -61
Get sequence