MirGeneDB

MirGeneDB ID

Mmu-Mir-430-P2

Family name MIR-430 (all species)
Seed AAGUGCU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-302b
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P3  Mmu-Mir-430-P4  Mmu-Mir-430-P5a  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P6  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b  Mmu-Mir-430-P7c 
Orthologues Aca-Mir-430-P2  Ami-Mir-430-P2  Bta-Mir-430-P2  Cfa-Mir-430-P2  Cli-Mir-430-P2  Cpi-Mir-430-P2  Cpo-Mir-430-P2  Dno-Mir-430-P2  Dre-Mir-430-o2a1  Dre-Mir-430-o2a2  Dre-Mir-430-o2a3  Dre-Mir-430-o2a4  Dre-Mir-430-o2a5  Dre-Mir-430-o2a6  Dre-Mir-430-o2a7  Dre-Mir-430-o2a8  Dre-Mir-430-o2a9  Dre-Mir-430-o2a10  Dre-Mir-430-o2a11  Dre-Mir-430-o2a12  Dre-Mir-430-o2a13  Dre-Mir-430-o2a14  Dre-Mir-430-o2b  Dre-Mir-430-o2c1  Dre-Mir-430-o2c2  Dre-Mir-430-o2c3  Dre-Mir-430-o2d1  Dre-Mir-430-o2d2  Ete-Mir-430-P2  Gga-Mir-430-P2  Hsa-Mir-430-P2  Mdo-Mir-430-P2  Mml-Mir-430-P2  Oan-Mir-430-P2  Ocu-Mir-430-P2  Rno-Mir-430-P2  Sha-Mir-430-P2  Tgu-Mir-430-P2  Xtr-Mir-430-P2 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr3: 127545238-127545297 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P2)
Mir-430-P2 chr3: 127545238-127545297 [+] UCSC Ensembl
Mir-430-P3 chr3: 127545368-127545427 [+] UCSC Ensembl
Mir-430-P1 chr3: 127545501-127545561 [+] UCSC Ensembl
Mir-430-P4 chr3: 127545629-127545687 [+] UCSC Ensembl
Mir-92-P2a chr3: 127545741-127545800 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUAGUUGCCUUGUGGGUGGGUUCCCUUCAACUUUAACAUGGGAAUGCUUUCUGUCUCAUCGAAGAGUAAGUGCUUCCAUGUUUUAGUAGAAGUGAAUUCAAGAAACUCUGGAAUAAGAA
Get precursor sequence
Structure
        10          20        30        40        50         
ACUAGUUGCCUUGUGGG--|      C    A   UU         AU    U  GUCUC 
                   UGGGUUC CUUC ACU  AACAUGGGA  GCUU CU     A
                   ACUUAAG GAAG UGA  UUGUACCUU  UGAA GA     U
AAGAAUAAGGUCUCAAAGA^      U    A   UU         CG    U  GAAGC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-430-P2_5p*

MirBase accessionMIMAT0003373
Sequence
0- ACUUUAACAUGGGAAUGCUUUCU -23
Get sequence
Validated targets microrna.org: MIMAT0003373
TargetScanVert: mmu-miR-302b-5p
miRDB: MIMAT0003373
Mature sequence

Mmu-Mir-430-P2_3p

MirBase accessionMIMAT0003374
Sequence
37- UAAGUGCUUCCAUGUUUUAGUAG -60
Get sequence
Validated targets microrna.org: MIMAT0003374
TargetScanVert: mmu-miR-302b-3p
miRDB: MIMAT0003374