MirGeneDB

MirGeneDB ID

Mmu-Mir-430-P3

Family name MIR-430 (all species)
Seed AGUGCUU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-302c
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P2  Mmu-Mir-430-P4  Mmu-Mir-430-P5a  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P6  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b  Mmu-Mir-430-P7c 
Orthologues Ami-Mir-430-P3  Bta-Mir-430-P3  Cfa-Mir-430-P3  Cli-Mir-430-P3  Cpi-Mir-430-P3  Cpo-Mir-430-P3  Dno-Mir-430-P3  Dre-Mir-430-o3a1  Dre-Mir-430-o3a2  Dre-Mir-430-o3a3  Dre-Mir-430-o3a4  Dre-Mir-430-o3a5  Dre-Mir-430-o3a6  Dre-Mir-430-o3a7  Dre-Mir-430-o3a8  Dre-Mir-430-o3a9  Dre-Mir-430-o3a10  Dre-Mir-430-o3a11  Dre-Mir-430-o3a12  Dre-Mir-430-o3a13  Dre-Mir-430-o3a14  Dre-Mir-430-o3a15  Dre-Mir-430-o3a16  Dre-Mir-430-o3b1  Dre-Mir-430-o3b2  Ete-Mir-430-P3  Gga-Mir-430-P3  Hsa-Mir-430-P3  Mdo-Mir-430-P3  Mml-Mir-430-P3  Oan-Mir-430-P3  Ocu-Mir-430-P3  Sha-Mir-430-P3  Tgu-Mir-430-P3 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr3: 127545368-127545427 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P3)
Mir-430-P2 chr3: 127545238-127545297 [+] UCSC Ensembl
Mir-430-P3 chr3: 127545368-127545427 [+] UCSC Ensembl
Mir-430-P1 chr3: 127545501-127545561 [+] UCSC Ensembl
Mir-430-P4 chr3: 127545629-127545687 [+] UCSC Ensembl
Mir-92-P2a chr3: 127545741-127545800 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAUUCAGAGUCUGAUGGGAGUCCCCUCUGCUUUAACAUGGGGUUACCUGCUGUGUUAAACAAAAGCAAGUGCUUCCAUGUUUCAGUGGGGGUGUCUUAAACUGUUCAACAUUUUCUCU
Get precursor sequence
Structure
        10            20        30        40        50         
UUAAUUCAGAGUCUGAU----|   GU     CU   UU         U   C    GUGUU 
                     GGGA  CCCCU  GCU  AACAUGGGG UAC UGCU     A
                     UUCU  GGGGG  UGA  UUGUACCUU GUG ACGA     A
UCUCUUUUACAACUUGUCAAA^   GU     --   CU         C   A    AAACA 
.       110       100        90          80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-430-P3_5p*

MirBase accessionMIMAT0003375
Sequence
0- GCUUUAACAUGGGGUUACCUGCU -23
Get sequence
Validated targets microrna.org: MIMAT0003375
TargetScanVert: mmu-miR-302c-5p
miRDB: MIMAT0003375
Mature sequence

Mmu-Mir-430-P3_3p

MirBase accessionMIMAT0003376
Sequence
38- AAGUGCUUCCAUGUUUCAGUGG -60
Get sequence
Validated targets microrna.org: MIMAT0003376
TargetScanVert: mmu-miR-302c-3p
miRDB: MIMAT0003376