MirGeneDB

MirGeneDB ID

Cpo-Mir-430-P3

Family name MIR-430 (all species)
Seed AAGUGCU
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-302c
Paralogues Cpo-Mir-430-o8  Cpo-Mir-430-P1  Cpo-Mir-430-P2  Cpo-Mir-430-P4  Cpo-Mir-430-P5 
Orthologues Ami-Mir-430-P3  Bta-Mir-430-P3  Cfa-Mir-430-P3  Cli-Mir-430-P3  Cpi-Mir-430-P3  Dno-Mir-430-P3  Dre-Mir-430-o3a1  Dre-Mir-430-o3a2  Dre-Mir-430-o3a3  Dre-Mir-430-o3a4  Dre-Mir-430-o3a5  Dre-Mir-430-o3a6  Dre-Mir-430-o3a7  Dre-Mir-430-o3a8  Dre-Mir-430-o3a9  Dre-Mir-430-o3a10  Dre-Mir-430-o3a11  Dre-Mir-430-o3a12  Dre-Mir-430-o3a13  Dre-Mir-430-o3a14  Dre-Mir-430-o3a15  Dre-Mir-430-o3a16  Dre-Mir-430-o3b1  Dre-Mir-430-o3b2  Ete-Mir-430-P3  Gga-Mir-430-P3  Hsa-Mir-430-P3  Mdo-Mir-430-P3  Mml-Mir-430-P3  Mmu-Mir-430-P3  Oan-Mir-430-P3  Ocu-Mir-430-P3  Sha-Mir-430-P3  Tgu-Mir-430-P3 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_43: 11472099-11472157 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-430-P3)
Mir-92-P2a scaffold_43: 11471746-11471805 [-] UCSC
Mir-430-P4 scaffold_43: 11471856-11471915 [-] UCSC
Mir-430-P1 scaffold_43: 11471975-11472035 [-] UCSC
Mir-430-P3 scaffold_43: 11472099-11472157 [-] UCSC
Mir-430-P2 scaffold_43: 11472221-11472282 [-] UCSC
Precursor
(pre-Mir +30nt flank)
CACCUCUAGCUCAGCCGAGGGGCCCCCUUUGCUUUAACAUGGGGGUACCUGCUGUGCAAAGGAAAGUAAGUGCUUCCAUGUUUGAGUGGAGGUGUCUCCCGAGCAGCACGACCUCCGCA
Get precursor sequence
Structure
        10         20         30        40        50         
CACCUCUAGCUCAGCCGA-    CCC-|   UG   U             C    GUGCA 
                   GGGG    CCUU  CUU AACAUGGGGGUAC UGCU     \
                   CCCU    GGAG  GAG UUGUACCUUCGUG AUGA     A
ACGCCUCCAGCACGACGAG    CUGU^   GU   U             A    AAGGA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Cpo-Mir-430-P3_5p* (predicted)

MirBase accessionMIMAT0047150
Sequence
0- GCUUUAACAUGGGGGUACCUGCU -23
Get sequence
Mature sequence

Cpo-Mir-430-P3_3p

MirBase accessionMIMAT0047151
Sequence
36- UAAGUGCUUCCAUGUUUGAGUGG -59
Get sequence