
MirGeneDB ID


Family name MIR-430 (all species)
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-302d
Paralogues Mmu-Mir-430-P1  Mmu-Mir-430-P2  Mmu-Mir-430-P3  Mmu-Mir-430-P5a  Mmu-Mir-430-P5b  Mmu-Mir-430-P5c  Mmu-Mir-430-P6  Mmu-Mir-430-P7a  Mmu-Mir-430-P7b  Mmu-Mir-430-P7c 
Orthologues Ami-Mir-430-P4  Bta-Mir-430-P4  Cfa-Mir-430-P4  Cli-Mir-430-P4  Cpi-Mir-430-P4  Cpo-Mir-430-P4  Dno-Mir-430-P4  Ete-Mir-430-P4  Gga-Mir-430-P4  Hsa-Mir-430-P4  Mdo-Mir-430-P4  Mml-Mir-430-P4  Oan-Mir-430-P4  Ocu-Mir-430-P4  Rno-Mir-430-P4  Tgu-Mir-430-P4  Xtr-Mir-430-o4a  Xtr-Mir-430-o4b  Xtr-Mir-430-o4c  Xtr-Mir-430-o4d  Xtr-Mir-430-o4e  Xtr-Mir-430-o4f  Xtr-Mir-430-o4g  Xtr-Mir-430-o4h  Xtr-Mir-430-o4j  Xtr-Mir-430-o4k  Xtr-Mir-430-o4l  Xtr-Mir-430-o4m  Xtr-Mir-430-o4n 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
chr3: 127545629-127545687 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P4)
Mir-430-P2 chr3: 127545238-127545297 [+] UCSC Ensembl
Mir-430-P3 chr3: 127545368-127545427 [+] UCSC Ensembl
Mir-430-P1 chr3: 127545501-127545561 [+] UCSC Ensembl
Mir-430-P4 chr3: 127545629-127545687 [+] UCSC Ensembl
Mir-92-P2a chr3: 127545741-127545800 [+] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50         
CCACUCAAGUCUGCUUA---|      U  UU     U                CUGUGCA 
                    AGGGGCC CC  UACUU AACAUGGAGGCACUUG       \
                    UCCUCGG GG  GUGAG UUGUACCUUCGUGAAU       U
GUCGUGUUACUUCUAAUUCA^      U  U-     U                AAAAAUU 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence


MirBase accessionMIMAT0017225
Get sequence
Validated targets TargetScanVert: mmu-miR-302d-5p
miRDB: MIMAT0017225
Mature sequence


MirBase accessionMIMAT0003377
Get sequence
Validated targets microrna.org: MIMAT0003377
TargetScanVert: mmu-miR-302d-3p
miRDB: MIMAT0003377