MirGeneDB

MirGeneDB ID

Ete-Mir-430-P4

Family name MIR-430 (all species)
Seed AAGUGCU
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-430-P1  Ete-Mir-430-P2  Ete-Mir-430-P3  Ete-Mir-430-P5  Ete-Mir-430-P8 
Orthologues Ami-Mir-430-P4  Bta-Mir-430-P4  Cfa-Mir-430-P4  Cli-Mir-430-P4  Cpi-Mir-430-P4  Cpo-Mir-430-P4  Dno-Mir-430-P4  Gga-Mir-430-P4  Hsa-Mir-430-P4  Mdo-Mir-430-P4  Mml-Mir-430-P4  Mmu-Mir-430-P4  Oan-Mir-430-P4  Ocu-Mir-430-P4  Rno-Mir-430-P4  Tgu-Mir-430-P4  Xtr-Mir-430-o4a  Xtr-Mir-430-o4b  Xtr-Mir-430-o4c  Xtr-Mir-430-o4d  Xtr-Mir-430-o4e  Xtr-Mir-430-o4f  Xtr-Mir-430-o4g  Xtr-Mir-430-o4h  Xtr-Mir-430-o4j  Xtr-Mir-430-o4k  Xtr-Mir-430-o4l  Xtr-Mir-430-o4m  Xtr-Mir-430-o4n 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(echTel2)
JH980307: 56022999-56023060 [-] UCSC
Precursor
(pre-Mir +30nt flank)
UGUCUGCUGUACUAUGCGGGGACCCCCUCUACUCUAACACGGCGGCACUUGCUGUGGCUUUUUGGAAAUUAAGUGCUUCCAUGUUUGAGUGUGGUGAAUCCUAACUUUAUUUUCAAUACACC
Get precursor sequence
Structure
        10          20         30        40        50        60
UGUCUGCUGUACUAUGCG--    CCC-| UC     U    C  C        CUGUGGCU 
                    GGGA    CC  UACUC AACA GG GGCACUUG        U
                    UCCU    GG  GUGAG UUGU CC UCGUGAAU        U
CCACAUAACUUUUAUUUCAA    AAGU^ U-     U    A  U        UAAAGGUU 
120       110       100         90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
To
Star sequence

Ete-Mir-430-P4_5p* (predicted)

MirBase accessionNone
Sequence
0- ACUCUAACACGGCGGCACUUGCU -23
Get sequence
Mature sequence

Ete-Mir-430-P4_3p

MirBase accessionNone
Sequence
39- UAAGUGCUUCCAUGUUUGAGUGU -62
Get sequence