MirGeneDB ID | Ete-Mir-430-P8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-430 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Ete-Mir-430-P1 Ete-Mir-430-P2 Ete-Mir-430-P3 Ete-Mir-430-P4 Ete-Mir-430-P5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Cja-Mir-430-P8 Dno-Mir-430-P8 Hsa-Mir-430-P8a Hsa-Mir-430-P8b Mml-Mir-430-P8 Pab-Mir-430-P8 Xla-Mir-430-o8a Xla-Mir-430-o8b Xtr-Mir-430-o8 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (echTel2) |
JH980399: 668630-668689 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-430-P8) |
Mir-430-P8
JH980399: 668630-668689 [+]
UCSC
Mir-430-P5 JH980399: 699442-699501 [+] UCSC Novel-3 JH980399: 703052-703110 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AAGUGCU | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CUCCAGUGGCGAGUGACCUCGGUCCGGAACGCUCAGCCCUGGGGGCACUUUCUUGGUACCUGCAAAGAAAGUGCUGUCAGAGUUGAGGAUCCCUGGCUGCAGGAAGGCGUCUGGCUUCGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 CUCCAGUGGCGAGUGAC- -| C AACG C G UGGUA CU CGGUC GG CUCAGC CUGG GGCACUUUCU C GA GUCGG CC GAGUUG GACU UCGUGAAAGA C UGCUUCGGUCUGCGGAAG C^ U CUAG A G AACGU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | The Dicer cut in tenrec is +1 relative to human generating a seed-shifted mature 3p read. Armadillo the only other taxon with reads from this miRNA expresses both versions equally but lowly and thus it is unclear which version predominates in vivo. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ete-Mir-430-P8_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- GCUCAGCCCUGGGGGCACUUUCU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ete-Mir-430-P8_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
37- AAAGUGCUGUCAGAGUUGAGGAU -60
Get sequence
|