MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P8b

Family name MIR-430 (all species)
Seed AGUGCUG
Species Human (Homo sapiens)
MiRBase ID hsa-mir-512-2
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P6  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P14  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P25  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P28  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P32  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues Cpo-Mir-430-o8  Dno-Mir-430-P8  Ete-Mir-430-P8  Mml-Mir-430-P8 
Node of Origin (locus) H. sapiens
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53666693-53666750 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P8b)
Mir-430-P8b chr19: 53666693-53666750 [+] UCSC Ensembl
Mir-430-P8a chr19: 53669177-53669234 [+] UCSC Ensembl
Mir-1323 chr19: 53671978-53672033 [+] UCSC Ensembl
Mir-498 chr19: 53674230-53674289 [+] UCSC Ensembl
Mir-430-P35 chr19: 53675725-53675785 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUACAGGGAGGGUACUUCUCAGUCUGUGGCACUCAGCCUUGAGGGCACUUUCUGGUGCCAGAAUGAAAGUGCUGUCAUAGCUGAGGUCCAAUGACUGAGGCGAGCACCGAAGAAACAC
Get precursor sequence
Structure
        10          20        30        40        50        
AUACAGGGAGGGUACUU--|      UG   CA      CU   G         UGGUG 
                   CUCAGUC  UGG  CUCAGC  UGA GGCACUUUC     C
                   GAGUCAG  ACC  GAGUCG  ACU UCGUGAAAG     C
CACAAAGAAGCCACGAGCG^      UA   UG      AU   G         UAAGA 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-430-P8b_5p*

MirBase accessionMIMAT0002822
Sequence
0- ACUCAGCCUUGAGGGCACUUUC -22
Get sequence
Validated targets microrna.org: MIMAT0002822
TargetScanVert: hsa-miR-512-5p
TargetMiner: hsa-miR-512-5p
miRDB: MIMAT0002822
Mature sequence

Hsa-Mir-430-P8b_3p

MirBase accessionMIMAT0002823
Sequence
36- AAGUGCUGUCAUAGCUGAGGUC -58
Get sequence
Validated targets microrna.org: MIMAT0002823
TargetScanVert: hsa-miR-512-3p
TargetMiner: hsa-miR-512-3p
miRDB: MIMAT0002823