MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P14

Family name MIR-430 (all species)
Seed UCUGGAG
Species Human (Homo sapiens)
MiRBase ID hsa-mir-516b-2
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P6  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P8b  Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P25  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P28  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P32  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues Sha-Mir-430-o14 
Node of Origin (locus) H. sapiens
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53725457-53725514 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P14)
Mir-430-P39b chr19: 53716608-53716668 [+] UCSC Ensembl
Mir-430-P34 chr19: 53720111-53720170 [+] UCSC Ensembl
Mir-430-P15b chr19: 53721081-53721139 [+] UCSC Ensembl
Mir-430-P37b chr19: 53722182-53722241 [+] UCSC Ensembl
Mir-430-P14 chr19: 53725457-53725514 [+] UCSC Ensembl
Mir-430-P46 chr19: 53726928-53726982 [+] UCSC Ensembl
Mir-430-P23 chr19: 53729853-53729911 [+] UCSC Ensembl
Mir-430-P18 chr19: 53731019-53731078 [+] UCSC Ensembl
Mir-430-P22 chr19: 53734892-53734950 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGGAGCAAGAAGAUCUCAUGAUGUGACCAUCUGGAGGUAAGAAGCACUUUGUGUUUUGUGAAAGAAAGUGCUUCCUUUCAGAGGGUUACUCUUUGAGAAAAGCAGCAUUGAAGUUG
Get precursor sequence
Structure
        10           20         30        40        50         
GCUGGAGCAAGAAGAUC---   U-| U      A        UAA          GUGUUU 
                    UCA  GA GUGACC UCUGGAGG   GAAGCACUUU      U
                    AGU  CU CAUUGG AGACUUUC   CUUCGUGAAA      G
GUUGAAGUUACGACGAAAAG   UU^ -      G        ---          GAAAGU 
      110       100         90        80           70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-430-P14_5p

MirBase accessionMIMAT0002859
Sequence
0- AUCUGGAGGUAAGAAGCACUUUGU -24
Get sequence
Validated targets microrna.org: MIMAT0002859
TargetScanVert: hsa-miR-516b-5p
TargetMiner: hsa-miR-516b-5p
miRDB: MIMAT0002859
Star sequence

Hsa-Mir-430-P14_3p*

MirBase accessionMIMAT0002860
Sequence
36- AAAGUGCUUCCUUUCAGAGGGU -58
Get sequence
Validated targets microrna.org: MIMAT0002860
TargetScanVert: hsa-miR-516b-3p
TargetMiner: hsa-miR-516b-3p
miRDB: MIMAT0002860