MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P25

Family name MIR-430 (all species)
Seed CUCUAGA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-519a-1
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P6  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P8b  Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P14  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P28  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P32  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues Sha-Mir-430-o25 
Node of Origin (locus) H. sapiens
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53752410-53752470 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P25)
Mir-430-P37a chr19: 53742528-53742587 [+] UCSC Ensembl
Mir-430-P39a chr19: 53748650-53748710 [+] UCSC Ensembl
Mir-430-P41 chr19: 53751226-53751285 [+] UCSC Ensembl
Mir-430-P25 chr19: 53752410-53752470 [+] UCSC Ensembl
Mir-430-P48 chr19: 53754031-53754089 [+] UCSC Ensembl
Mir-430-P11a chr19: 53756756-53756818 [+] UCSC Ensembl
Mir-430-P50 chr19: 53758246-53758304 [+] UCSC Ensembl
Mir-430-P11b chr19: 53761148-53761210 [+] UCSC Ensembl
Mir-430-P26 chr19: 53762358-53762418 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCCGGAGCAAGAAGACCUCAGGCUGUGACACUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAGGAAAGUGCAUCCUUUUAGAGUGUUACUGUUUGAGAAAAGCAACAUUGAAGCUG
Get precursor sequence
Structure
        10          20        30        40        50          
UGCCGGAGCAAGAAGAC--|      U                 A         GUUGUCU 
                   CUCAGGC GUGACACUCUAGAGGGA GCGCUUUCU       \
                   GAGUUUG CAUUGUGAGAUUUUCCU CGUGAAAGG       G
GUCGAAGUUACAACGAAAA^      U                 A         AAAGAAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-430-P25_5p

MirBase accessionMIMAT0005452
Sequence
0- ACUCUAGAGGGAAGCGCUUUCU -22
Get sequence
Validated targets microrna.org: MIMAT0005452
TargetScanVert: hsa-miR-519a-5p
TargetMiner: hsa-miR-519a-5p
miRDB: MIMAT0005452
Star sequence

Hsa-Mir-430-P25_3p*

MirBase accessionMIMAT0002869
Sequence
39- AAAGUGCAUCCUUUUAGAGUGU -61
Get sequence
Validated targets microrna.org: MIMAT0002869
TargetScanVert: hsa-miR-519a-3p
TargetMiner: hsa-miR-519a-3p
miRDB: MIMAT0002869