MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P6

Family name MIR-430 (all species)
Seed AAGUGCU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-372
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P8b  Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P14  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P25  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P28  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P32  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues Dno-Mir-430-P6  Mml-Mir-430-P6  Mmu-Mir-430-P6  Rno-Mir-430-P6a  Rno-Mir-430-P6b  Xtr-Mir-430-o6 
Node of Origin (locus) Eutheria
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53787895-53787953 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P6)
Mir-430-P5 chr19: 53787680-53787738 [+] UCSC Ensembl
Mir-430-P6 chr19: 53787895-53787953 [+] UCSC Ensembl
Mir-430-P7 chr19: 53788710-53788770 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUGCAGAUGGAGCUGCUCACCCUGUGGGCCUCAAAUGUGGAGCACUAUUCUGAUGUCCAAGUGGAAAGUGCUGCGACAUUUGAGCGUCACCGGUGACGCCCAUAUCAACGGAUGCCG
Get precursor sequence
Structure
        10           20        30         40         50         
UCUUGCAGAUGGAGCUGC---|    CU    G -         - G      A    GAUGU 
                     UCACC  GUGG C CUCAAAUGU G AGCACU UUCU     \
                     AGUGG  CACU G GAGUUUACA C UCGUGA AAGG     C
GCCGUAGGCAACUAUACCCGC^    C-    - C         G G      -    UGAAC 
       110       100         90         80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-430-P6_5p*

MirBase accessionMIMAT0026484
Sequence
0- CCUCAAAUGUGGAGCACUAUUCU -23
Get sequence
Validated targets TargetScanVert: hsa-miR-372-5p
miRDB: MIMAT0026484
Mature sequence

Hsa-Mir-430-P6_3p

MirBase accessionMIMAT0000724
Sequence
36- AAAGUGCUGCGACAUUUGAGCGU -59
Get sequence
Validated targets microrna.org: MIMAT0000724
TargetScanVert: hsa-miR-372-3p
miRDB: MIMAT0000724