MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P28

Family name MIR-430 (all species)
Seed AAGUGCA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-519c
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P6  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P8b  Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P14  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P25  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P32  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues Mml-Mir-430-P28  Sto-Mir-430-o28 
Node of Origin (locus) Catarrhini
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53686484-53686543 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P28)
Mir-430-P9b chr19: 53679016-53679074 [+] UCSC Ensembl
Mir-430-P30 chr19: 53679953-53680011 [+] UCSC Ensembl
Mir-430-P36 chr19: 53682173-53682233 [+] UCSC Ensembl
Mir-430-P9a chr19: 53685022-53685080 [+] UCSC Ensembl
Mir-430-P28 chr19: 53686484-53686543 [+] UCSC Ensembl
Mir-430-P49 chr19: 53688495-53688553 [+] UCSC Ensembl
Mir-430-P31 chr19: 53690895-53690953 [+] UCSC Ensembl
Mir-430-P47 chr19: 53694406-53694464 [+] UCSC Ensembl
Mir-430-P27 chr19: 53695225-53695284 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCUGGAGCAAGAAGAUCUCAGCCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCAUCUUUUUAGAGGAUUACAGUUUGAGAAAAGCAACGUUAACGUUC
Get precursor sequence
Structure
        10           20        30        40        50         
GCUGGAGCAAGAAGAUC---|   C      C            A         GUUGUCU 
                    UCAG CUGUGA CCUCUAGAGGGA GCGCUUUCU       \
                    AGUU GACAUU GGAGAUUUUUCU CGUGAAAGA       G
CUUGCAAUUGCAACGAAAAG^   U      A            A         AAAGAAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-430-P28_5p*

MirBase accessionMIMAT0002831
Sequence
0- CUCUAGAGGGAAGCGCUUUCUG -22
Get sequence
Validated targets microrna.org: MIMAT0002831
TargetScanVert: hsa-miR-519c-5p
TargetMiner: hsa-miR-519c-5p
miRDB: MIMAT0002831
Mature sequence

Hsa-Mir-430-P28_3p

MirBase accessionMIMAT0002832
Sequence
38- AAAGUGCAUCUUUUUAGAGGAU -60
Get sequence
Validated targets microrna.org: MIMAT0002832
TargetScanVert: hsa-miR-519c-3p
TargetMiner: hsa-miR-519c-3p
miRDB: MIMAT0002832