MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P32

Family name MIR-430 (all species)
Seed AAGUGCU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-520b
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P6  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P8b  Hsa-Mir-430-P9a  Hsa-Mir-430-P9b  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P14  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P25  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P28  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues
Node of Origin (locus) H. sapiens
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53701228-53701288 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P32)
Mir-430-P47 chr19: 53694406-53694464 [+] UCSC Ensembl
Mir-430-P27 chr19: 53695225-53695284 [+] UCSC Ensembl
Mir-430-P44 chr19: 53697547-53697605 [+] UCSC Ensembl
Mir-430-P42 chr19: 53698400-53698458 [+] UCSC Ensembl
Mir-430-P24 chr19: 53700030-53700088 [+] UCSC Ensembl
Mir-430-P32 chr19: 53701228-53701288 [+] UCSC Ensembl
Mir-430-P20 chr19: 53702750-53702808 [+] UCSC Ensembl
Mir-430-P45 chr19: 53706266-53706324 [+] UCSC Ensembl
Mir-430-P33 chr19: 53707468-53707527 [+] UCSC Ensembl
Mir-430-P21 chr19: 53708759-53708817 [+] UCSC Ensembl
Mir-430-P43 chr19: 53711017-53711075 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCCACAGCAAGAAGAUGUCAGGCUGUGUCCCUCUACAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCUUCCUUUUAGAGGGUUACCGUUUAAGAAAAGCAACGUUUAGGUGG
Get precursor sequence
Structure
        10        20          30        40        50          
UGCCACAGCAAGAAGAUGUC--|   U   U       C               GUUGUCU 
                      AGGC GUG CCCUCUA AGGGAAGCGCUUUCU       \
                      UUUG CAU GGGAGAU UUCCUUCGUGAAAGA       G
GGUGGAUUUGCAACGAAAAGAA^   C   U       U               AAAGAAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-430-P32_5p*

MirBase accessionMIMAT0037325
Sequence
0- CCUCUACAGGGAAGCGCUUUCU -22
Get sequence
Mature sequence

Hsa-Mir-430-P32_3p

MirBase accessionMIMAT0002843
Sequence
39- AAAGUGCUUCCUUUUAGAGGGU -61
Get sequence
Validated targets microrna.org: MIMAT0002843
TargetScanVert: hsa-miR-520b
miRDB: MIMAT0002843