MirGeneDB

MirGeneDB ID

Dno-Mir-430-P2

Family name MIR-430 (all species)
Seed AAGUGCU
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-302b
Paralogues Dno-Mir-430-P1  Dno-Mir-430-P3  Dno-Mir-430-P4  Dno-Mir-430-P5  Dno-Mir-430-P6  Dno-Mir-430-P8 
Orthologues Aca-Mir-430-P2  Ami-Mir-430-P2  Bta-Mir-430-P2  Cfa-Mir-430-P2  Cli-Mir-430-P2  Cpi-Mir-430-P2  Cpo-Mir-430-P2  Dre-Mir-430-o2a1  Dre-Mir-430-o2a2  Dre-Mir-430-o2a3  Dre-Mir-430-o2a4  Dre-Mir-430-o2a5  Dre-Mir-430-o2a6  Dre-Mir-430-o2a7  Dre-Mir-430-o2a8  Dre-Mir-430-o2a9  Dre-Mir-430-o2a10  Dre-Mir-430-o2a11  Dre-Mir-430-o2a12  Dre-Mir-430-o2a13  Dre-Mir-430-o2a14  Dre-Mir-430-o2b  Dre-Mir-430-o2c1  Dre-Mir-430-o2c2  Dre-Mir-430-o2c3  Dre-Mir-430-o2d1  Dre-Mir-430-o2d2  Ete-Mir-430-P2  Gga-Mir-430-P2  Hsa-Mir-430-P2  Mdo-Mir-430-P2  Mml-Mir-430-P2  Mmu-Mir-430-P2  Oan-Mir-430-P2  Ocu-Mir-430-P2  Rno-Mir-430-P2  Sha-Mir-430-P2  Tgu-Mir-430-P2  Xtr-Mir-430-P2 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH580080: 1519661-1519717 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P2)
Mir-92-P2a JH580080: 1519066-1519125 [-] UCSC Ensembl
Mir-430-P4 JH580080: 1519185-1519244 [-] UCSC Ensembl
Mir-430-P1 JH580080: 1519344-1519404 [-] UCSC Ensembl
Mir-430-P3 JH580080: 1519526-1519585 [-] UCSC Ensembl
Mir-430-P2 JH580080: 1519661-1519717 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGUCAUGUAGAAUGGACUGGACUCCCUUCAACUUUAACAUGGAGGUACUUUCUGUUUCUUAAAGUAAGUGCUUCCAUGUUUUAGUAGAAGUGUAUUCAAUUUGACCUUCUGGAUGAA
Get precursor sequence
Structure
        10          20        30        40        50        
GGUCAUGUAGAAUGGAC--|   CUCC    A   UU               U  GUUU 
                   UGGA    CUUC ACU  AACAUGGAGGUACUU CU    \
                   ACUU    GAAG UGA  UUGUACCUUCGUGAA GA    C
AAGUAGGUCUUCCAGUUUA^   AUGU    A   UU               U  AAUU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-430-P2_5p* (predicted)

MirBase accessionMIMAT0047793
Sequence
0- ACUUUAACAUGGAGGUACUUUCU -23
Get sequence
Mature sequence

Dno-Mir-430-P2_3p (predicted)

MirBase accessionMIMAT0047794
Sequence
34- UAAGUGCUUCCAUGUUUUAGUAG -57
Get sequence