MirGeneDB

MirGeneDB ID

Dno-Mir-430-P1

Family name MIR-430 (all species)
Seed AAGUGCU
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-302a
Paralogues Dno-Mir-430-P2  Dno-Mir-430-P3  Dno-Mir-430-P4  Dno-Mir-430-P5  Dno-Mir-430-P6  Dno-Mir-430-P8 
Orthologues Aca-Mir-430-P1  Ami-Mir-430-P1  Bta-Mir-430-P1  Cfa-Mir-430-P1  Cli-Mir-430-P1  Cpi-Mir-430-P1  Cpo-Mir-430-P1  Dre-Mir-430-o1a  Dre-Mir-430-o1b1  Dre-Mir-430-o1b2  Dre-Mir-430-o1b3  Dre-Mir-430-o1b4  Dre-Mir-430-o1b5  Dre-Mir-430-o1b6  Dre-Mir-430-o1b7  Dre-Mir-430-o1b8  Dre-Mir-430-o1c  Dre-Mir-430-o1d1  Dre-Mir-430-o1d2  Dre-Mir-430-o1d3  Dre-Mir-430-o1d4  Dre-Mir-430-o1d5  Dre-Mir-430-o1d6  Dre-Mir-430-o1d7  Dre-Mir-430-o1e1  Dre-Mir-430-o1e2  Dre-Mir-430-o1e3  Ete-Mir-430-P1  Gga-Mir-430-P1  Hsa-Mir-430-P1  Mdo-Mir-430-P1  Mml-Mir-430-P1  Mmu-Mir-430-P1  Oan-Mir-430-P1  Ocu-Mir-430-P1  Rno-Mir-430-P1  Sha-Mir-430-P1  Tgu-Mir-430-P1 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH580080: 1519344-1519404 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P1)
Mir-92-P2a JH580080: 1519066-1519125 [-] UCSC Ensembl
Mir-430-P4 JH580080: 1519185-1519244 [-] UCSC Ensembl
Mir-430-P1 JH580080: 1519344-1519404 [-] UCSC Ensembl
Mir-430-P3 JH580080: 1519526-1519585 [-] UCSC Ensembl
Mir-430-P2 JH580080: 1519661-1519717 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAAAUCUAUCAAGACUGGGCUCCCCACCACUUAAACGUGGAUGUACUUGCUUUAAAUCUAAAAAAGUAAGUGCUUCCAUGUUUUGGUGAUGGUGAGUCUUUUUACAUUUCAUGACUUCA
Get precursor sequence
Structure
        10          20        30        40        50          
UUCAAAUCUAUCAAGACU--|     C   C    U         U         UUAAAU 
                    GGGCUC CCA CACU AAACGUGGA GUACUUGCU      \
                    UCUGAG GGU GUGG UUUGUACCU CGUGAAUGA      C
ACUUCAGUACUUUACAUUUU^     U   A    U         U         AAAAAU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Star sequence

Dno-Mir-430-P1_5p* (predicted)

MirBase accessionMIMAT0047791
Sequence
0- ACUUAAACGUGGAUGUACUUGCU -23
Get sequence
Mature sequence

Dno-Mir-430-P1_3p (predicted)

MirBase accessionMIMAT0047792
Sequence
38- UAAGUGCUUCCAUGUUUUGGUGA -61
Get sequence