MirGeneDB

MirGeneDB ID

Aca-Mir-430-P1

Family name MIR-430 (all species)
Seed AAGUGCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-430-P2 
Orthologues Ami-Mir-430-P1  Bta-Mir-430-P1  Cfa-Mir-430-P1  Cli-Mir-430-P1  Cpi-Mir-430-P1  Cpo-Mir-430-P1  Dno-Mir-430-P1  Dre-Mir-430-o1a  Dre-Mir-430-o1b1  Dre-Mir-430-o1b2  Dre-Mir-430-o1b3  Dre-Mir-430-o1b4  Dre-Mir-430-o1b5  Dre-Mir-430-o1b6  Dre-Mir-430-o1b7  Dre-Mir-430-o1b8  Dre-Mir-430-o1c  Dre-Mir-430-o1d1  Dre-Mir-430-o1d2  Dre-Mir-430-o1d3  Dre-Mir-430-o1d4  Dre-Mir-430-o1d5  Dre-Mir-430-o1d6  Dre-Mir-430-o1d7  Dre-Mir-430-o1e1  Dre-Mir-430-o1e2  Dre-Mir-430-o1e3  Ete-Mir-430-P1  Gga-Mir-430-P1  Hsa-Mir-430-P1  Mdo-Mir-430-P1  Mml-Mir-430-P1  Mmu-Mir-430-P1  Oan-Mir-430-P1  Ocu-Mir-430-P1  Rno-Mir-430-P1  Sha-Mir-430-P1  Tgu-Mir-430-P1 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
5: 142963794-142963853 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P1)
Mir-430-P2 5: 142962983-142963042 [+] UCSC Ensembl
Mir-92-P2a 5: 142964152-142964211 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUCAUCCACGUGGUAAAGGAUUAUCCACUACUUUAAUAUGAAAGUACUUGUUUUUGUUCCUUUUAAAAAGUGCUUUCAUAUUUUAGUGAUGGCACAUCCUAUUUUAAUCAACUAUGCAA
Get precursor sequence
Structure
        10          20        30        40        50         
UCUCAUCCACGUGGUAA--|    UAU   C    UU               GUUUUUGU 
                   AGGAU   CCA UACU  AAUAUGAAAGUACUU        U
                   UCCUA   GGU GUGA  UUAUACUUUCGUGAA        C
AACGUAUCAACUAAUUUUA^    CAC   A    UU               AAAUUUUC 
.       110       100        90        80        70        60
Deep sequencing
3' NTU Unknown
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-430-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- ACUUUAAUAUGAAAGUACUUGUU -23
Get sequence
Mature sequence

Aca-Mir-430-P1_3p (predicted)

MirBase accessionNone
Sequence
37- AAAGUGCUUUCAUAUUUUAGUGA -60
Get sequence