MirGeneDB

MirGeneDB ID

Rno-Mir-430-P1

Family name MIR-430 (all species)
Seed AAGUGCU
Species Norway rat (Rattus norvegicus)
MiRBase ID
Paralogues Rno-Mir-430-P2  Rno-Mir-430-P4  Rno-Mir-430-P5a  Rno-Mir-430-P5b  Rno-Mir-430-P5c  Rno-Mir-430-P6a  Rno-Mir-430-P6b  Rno-Mir-430-P7a  Rno-Mir-430-P7b  Rno-Mir-430-P7c 
Orthologues Aca-Mir-430-P1  Ami-Mir-430-P1  Bta-Mir-430-P1  Cfa-Mir-430-P1  Cli-Mir-430-P1  Cpi-Mir-430-P1  Cpo-Mir-430-P1  Dno-Mir-430-P1  Dre-Mir-430-o1a  Dre-Mir-430-o1b1  Dre-Mir-430-o1b2  Dre-Mir-430-o1b3  Dre-Mir-430-o1b4  Dre-Mir-430-o1b5  Dre-Mir-430-o1b6  Dre-Mir-430-o1b7  Dre-Mir-430-o1b8  Dre-Mir-430-o1c  Dre-Mir-430-o1d1  Dre-Mir-430-o1d2  Dre-Mir-430-o1d3  Dre-Mir-430-o1d4  Dre-Mir-430-o1d5  Dre-Mir-430-o1d6  Dre-Mir-430-o1d7  Dre-Mir-430-o1e1  Dre-Mir-430-o1e2  Dre-Mir-430-o1e3  Ete-Mir-430-P1  Gga-Mir-430-P1  Hsa-Mir-430-P1  Mdo-Mir-430-P1  Mml-Mir-430-P1  Mmu-Mir-430-P1  Oan-Mir-430-P1  Ocu-Mir-430-P1  Sha-Mir-430-P1  Tgu-Mir-430-P1 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr2: 231875231-231875291 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCGUAAGUAUAAAGACUGGGCUUCCCACCACUUAAACGUGGUUGUCCUUGCUUUGGAACGAAGAAAGUAAGUGCUUCCAUGUUUGGGUGAUGGUAAGUUUUCCUUUAUCCUCACGCCUUU
Get precursor sequence
Structure
        10          20        30        40        50          
UUCGUAAGUAUAAAGACU--|     C   C             UU UC      UUGGAA 
                    GGGCUU CCA CACUUAAACGUGG  G  CUUGCU      \
                    UUUGAA GGU GUGGGUUUGUACC  C  GAAUGA      C
UUUCCGCACUCCUAUUUCCU^     U   A             UU GU      AAGAAG 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-430-P1_5p*

MirBase accessionNone
Sequence
0- ACUUAAACGUGGUUGUCCUUGCU -23
Get sequence
Mature sequence

Rno-Mir-430-P1_3p

MirBase accessionNone
Sequence
38- UAAGUGCUUCCAUGUUUGGGUGA -61
Get sequence