MirGeneDB

MirGeneDB ID

Rno-Mir-430-P7c

Family name MIR-430 (all species)
Seed AAGUGCU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-294
Paralogues Rno-Mir-430-P1  Rno-Mir-430-P2  Rno-Mir-430-P4  Rno-Mir-430-P5a  Rno-Mir-430-P5b  Rno-Mir-430-P5c  Rno-Mir-430-P6a  Rno-Mir-430-P6b  Rno-Mir-430-P7a  Rno-Mir-430-P7b 
Orthologues Bta-Mir-430-P7  Hsa-Mir-430-P7  Mml-Mir-430-P7  Mmu-Mir-430-P7c  Xtr-Mir-430-o7 
Node of Origin (locus) Muridae
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr1: 64536751-64536808 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P7c)
Mir-430-P6b chr1: 64536633-64536691 [-] UCSC Ensembl
Mir-430-P7c chr1: 64536751-64536808 [-] UCSC Ensembl
Mir-430-P5c chr1: 64537114-64537171 [-] UCSC Ensembl
Mir-430-P7b chr1: 64537854-64537910 [-] UCSC Ensembl
Mir-430-P5b chr1: 64538128-64538189 [-] UCSC Ensembl
Mir-430-P7a chr1: 64538418-64538475 [-] UCSC Ensembl
Mir-430-P5a chr1: 64538716-64538773 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGGAUCUUGGAAAAACCACCAUAGCCAUGCUCAAAAUGGAGGCCCUAUCUAAGCUUUUAAGUAGAAAGUGCUUCCAUUUUGUGUGUUGCUGUGUGGAAGAAGGCAUCCGGGACUUC
Get precursor sequence
Structure
        10           20        30        40        50        
GGAGGAUCUUGGAAAAA---|   C     C    U            C  A   AAGCU 
                    CCAC AUAGC AUGC CAAAAUGGAGGC CU UCU     U
                    GGUG UGUCG UGUG GUUUUACCUUCG GA AGA     U
CUUCAGGGCCUACGGAAGAA^   -     U    U            U  A   UGAAU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-430-P7c_5p*

MirBase accessionMIMAT0012848
Sequence
0- GCUCAAAAUGGAGGCCCUAUCU -22
Get sequence
Validated targets microrna.org: MIMAT0012848
TargetScanVert: rno-miR-294
miRDB: MIMAT0012848
Mature sequence

Rno-Mir-430-P7c_3p

MirBase accessionNone
Sequence
36- AAAGUGCUUCCAUUUUGUGUGU -58
Get sequence