| MirGeneDB ID | Pfl-Mir-92-o41 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Ptychodera (Ptychodera flava) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pfl-Mir-92-o42 Pfl-Mir-92-o43 Pfl-Mir-92-o44 Pfl-Mir-92-o45 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. flava | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pfl) |
LD343282.1: 96920-96979 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o41) |
Mir-92-o41
LD343282.1: 96920-96979 [+]
Mir-92-o42 LD343282.1: 114848-114906 [+] Mir-92-o43 LD343282.1: 115115-115177 [+] Mir-92-o44 LD343282.1: 115395-115459 [+] Mir-92-o45 LD343282.1: 115958-116021 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUCAAAGUCCAUUCGUAGCUGCUAUCUCCCCGGCUCGGAUGAGGACAAUGUUGUGACGUCACUACCAAUAUUGCACUCGUCCCGGCCUUAGAGUGGCAGCACCUUUAUCGACCAAUGCCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 AUCAAAGUCCAUUCGUA---| U CCC C GA GUGACG GCUGCUA CUC GGCU GGAUGAG CAAUGUU U CGACGGU GAG CCGG CCUGCUC GUUAUAA C ACCGUAACCAGCUAUUUCCA^ - AUU C AC CCAUCA . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pfl-Mir-92-o41_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGCUCGGAUGAGGACAAUGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pfl-Mir-92-o41_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UAUUGCACUCGUCCCGGCCUUA -60
Get sequence
|
