MirGeneDB ID | Pve-Mir-92-o100 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Vernerds tusk shell (Pictodentalium vernedei) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Pve-Mir-92-o98 Pve-Mir-92-o99 Pve-Mir-92-o101 Pve-Mir-92-o102 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Dentaliidae | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Pve_genome_chr_only) |
Pve_Chr5: 212132384-212132441 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o100) |
Mir-92-o101
Pve_Chr5: 212132207-212132264 [+]
Ensembl
Mir-92-o100 Pve_Chr5: 212132384-212132441 [+] Ensembl Mir-92-o99 Pve_Chr5: 212132835-212132894 [+] Ensembl Mir-92-o98 Pve_Chr5: 212134936-212134993 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GUCUUCACAUGUUUUCCAGCUUCGCGUGACAGACCGAGUGAGUGUAAUCGGUUGUAUCUUUAUUCCAAUUGCACUCGUCCCGGCCUGCCUCGAGGGGUCGUUACCUGCAGUGUGGAAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 GUCUUCACAUGUUUUCCA-- G UGA A AG-| C UUGUAU GCUUC CG CAG CCG UGAGUGUAAU GG \ UGGGG GC GUC GGC GCUCACGUUA CC C UAAGGUGUGACGUCCAUUGC A UCC C CCU^ A UUAUUU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as oPveans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Pve-Mir-92-o100_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGACCGAGUGAGUGUAAUCGG -21
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Pve-Mir-92-o100_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
36- AAUUGCACUCGUCCCGGCCUGC -58
Get sequence
|