MirGeneDB ID | Llo-Mir-92-o129 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Bootlace worm (Lineus longissimus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Llo-Mir-92-o126 Llo-Mir-92-o127 Llo-Mir-92-o128 Llo-Mir-92-o130 Llo-Mir-92-o131 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Lineidae | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_910592395.2_tnLinLong1) |
OU343005.1: 13162806-13162859 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o129) |
Mir-92-o126
OU343005.1: 13161856-13161915 [+]
Ensembl
Mir-92-o127 OU343005.1: 13162175-13162233 [+] Ensembl Mir-92-o128 OU343005.1: 13162433-13162490 [+] Ensembl Mir-92-o129 OU343005.1: 13162806-13162859 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
CAUUCAAAUGAUACGCCGUGUUUCAUUAGUAGGUUGUGAUGUUUGCAAUCUGUUCAUUGUCAAAUUGCACUCGUCCCGGCCUGCUAUAAAGCGGCAAGGCAACGUGAAUAACAAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 CAUUCAAAUGAUACGCC-- -| CAU U UU C UUC G UGUUU UAGUAGGUUG GAUG UGCAAU UG A C GCGAA AUCGUCCGGC CUGC ACGUUA AC U AACAAUAAGUGCAACGGAA G^ AU- C UC A UGU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Llo-Mir-92-o129_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGUUGUGAUGUUUGCAAUCUGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Llo-Mir-92-o129_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
32- AAUUGCACUCGUCCCGGCCUGC -54
Get sequence
|