MirGeneDB ID | Efe-Mir-92-o39 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Common brandling worm (Eisenia fetida) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Efe-Mir-92-o40 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 Snu-Mir-92-o39 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | E. fetida | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Efe_combined) |
Efet.01.162814: 4080-4143 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UGAGCCAUAUUGGCGUCGAAUCAGGAAAACAGGUCUGUUUUGGUGCAAACUUGGUUUCAUUGGCUAUAUUCCAAUUGCACUGAUCCCGGCCUGCUUGACUUGAAAAUGUCUUUAUUGCCAAUUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 UGAGCCAUAUUGGCGUCGAA- AA -| UGUU UG AC UUUCAUU UCAGG AA CAGGUC U GUGCAA UUGG G AGUUC UU GUCCGG A CACGUU AACC G AUUAACCGUUAUUUCUGUAAA AG C^ CCCU GU -- UUAUAUC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Efe-Mir-92-o39_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGUCUGUUUUGGUGCAAACUUGG -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Efe-Mir-92-o39_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
42- AAUUGCACUGAUCCCGGCCUGC -64
Get sequence
|