MirGeneDB ID | Snu-Mir-92-o39 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Peanut worm (Sipunculus nudus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Snu-Mir-92-o36 Snu-Mir-92-o37 Snu-Mir-92-o38 Snu-Mir-92-o40 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Efe-Mir-92-o39 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | S. nudus | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_026874595.1_ASM2687459v1_Sipunculus_nudus) |
CM049309.1: 91525315-91525371 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o39) |
Mir-92-o36
CM049309.1: 91505725-91505788 [+]
Mir-92-o37 CM049309.1: 91516975-91517033 [+] Mir-92-o38 CM049309.1: 91520435-91520495 [+] Mir-92-o39 CM049309.1: 91525315-91525371 [+] Mir-92-o40 CM049309.1: 91533788-91533844 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UUCUUGUUGGACCUUGAGGUGUGUCAUAGCAGGGUGUGACUUGUGCAUUACUGAAAACAGGAACAGAUUGCACUUGUCCCGGCCUGCUGUGUAUCACCAGUCGCAGCUGAUAGAUAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 UUCUUGUUGGACCUUGA--| UGU G U UU UUA AAAA GGUG CAUAGCAGG UG GAC GUGCA CUG C CCAC GUGUCGUCC GC CUG CACGU GAC A UAUAGAUAGUCGACGCUGA^ UAU G C UU UA- AAGG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Snu-Mir-92-o39_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGGUGUGACUUGUGCAUUACUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Snu-Mir-92-o39_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
35- GAUUGCACUUGUCCCGGCCUGC -57
Get sequence
|