MirGeneDB

MirGeneDB ID

Sto-Mir-92-P1d

Family name MIR-92 (all species)
Seed AUUGCAC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-92-P1a  Sto-Mir-92-P1b  Sto-Mir-92-P1c  Sto-Mir-92-P2b  Sto-Mir-92-P2d 
Orthologues Asu-Mir-92  Bfl-Mir-92-o1  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01001891.1: 348887-348945 [+]
Precursor
(pre-Mir +30nt flank)
AUGCCUGGAAGCUGAUCCCCUGUUUUGUGAAGGUUGGGACGGGCAGCAGUAUUUACAGUUGGAUUGAUAUUGCACUUGUCCCGGCCUACACAGGUCAAGAGGUAACGAUGUCAUGUGGG
Get precursor sequence
Structure
        10         20         30        40        50         
AUGCCUGGAAGCUGAUCCC-  GU-|     A             CA        UACAG 
                    CU   UUUGUG AGGUUGGGACGGG  GCAGUAUU     U
                    GA   GGACAC UCCGGCCCUGUUC  CGUUAUAG     U
GGGUGUACUGUAGCAAUGGA  ACU^     A             A-        UUAGG 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Sto-Mir-92-P1d_5p*

MirBase accessionNone
Sequence
0- AGGUUGGGACGGGCAGCAGUAUU -23
Get sequence
Mature sequence

Sto-Mir-92-P1d_3p

MirBase accessionNone
Sequence
37- UAUUGCACUUGUCCCGGCCUAC -59
Get sequence