| MirGeneDB ID | Cte-Mir-92-o61 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Polychaete worm (Capitella teleta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cte-Mir-92-o36 Cte-Mir-92-o37 Cte-Mir-92-o38 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | C. teleta | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Capitella_teleta_v1.0) |
CAPTEscaffold_14: 595402-595468 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o61) |
Mir-92-o38
CAPTEscaffold_14: 594225-594286 [-]
Ensembl
Mir-92-o37 CAPTEscaffold_14: 594348-594403 [-] Ensembl Mir-92-o36 CAPTEscaffold_14: 595238-595297 [-] Ensembl Mir-92-o61 CAPTEscaffold_14: 595402-595468 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AUGCGGAGAUGACUGCACUUGACUACAAGUAGGCCUUGACUCGUGCAACUUUGAGCCGCGAUUCUGUACACCACAAAUUGCACUUGUCCCGGCCUGCCUGUGGUCAUGCCUCGCAGCGGCAUGCAUGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AUGCGGAGAUGACUGCACU--| A UU UC C AGCCGCGAU UGACUACA GUAGGCC GAC GUGCAA UUUG U ACUGGUGU CGUCCGG CUG CACGUU AAAC C GUACGUACGGCGACGCUCCGU^ C CC UU - ACCACAUGU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cte-Mir-92-o61_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGCCUUGACUCGUGCAACUUUG -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cte-Mir-92-o61_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
45- AAUUGCACUUGUCCCGGCCUGC -67
Get sequence
|
