MirGeneDB ID | Ofu-Mir-92-o141 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Ofu-Mir-92-o142 Ofu-Mir-92-o143 Ofu-Mir-92-o144 Ofu-Mir-92-o145 Ofu-Mir-92-o146 Ofu-Mir-92-o147 Ofu-Mir-92-o148 Ofu-Mir-92-o149 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000007.1: 16102466-16102523 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o141) |
Mir-92-o146
CAIIXF020000007.1: 16092897-16092953 [-]
Mir-92-o145 CAIIXF020000007.1: 16093752-16093810 [-] Mir-92-o144 CAIIXF020000007.1: 16094086-16094141 [-] Mir-92-o143 CAIIXF020000007.1: 16094923-16094980 [-] Mir-92-o142 CAIIXF020000007.1: 16098734-16098792 [-] Mir-92-o141 CAIIXF020000007.1: 16102466-16102523 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AUGCUUAUUUACUCACUGUUAACCUCUUUGAGUCUGGGAUUAGAGCAGUGUUGAAUAUCUCACUAAUAUUGCACUUGUCCCGGCCUUAGAGGGGUUAAUUUUACCUGCAUGGAUUAAUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AUGCUUAUUUACUCACU--| U U A GAAUA GUUAACCUCUUUGAG CUGGGAU AG GCAGUGUU U UAAUUGGGGAGAUUC GGCCCUG UC CGUUAUAA C UAAUUAGGUACGUCCAUUU^ C U A UCACU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ofu-Mir-92-o141_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGUCUGGGAUUAGAGCAGUGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ofu-Mir-92-o141_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
36- UAUUGCACUUGUCCCGGCCUUA -58
Get sequence
|