MirGeneDB ID | Ofu-Mir-92-o149 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Ofu-Mir-92-o141 Ofu-Mir-92-o142 Ofu-Mir-92-o143 Ofu-Mir-92-o144 Ofu-Mir-92-o145 Ofu-Mir-92-o146 Ofu-Mir-92-o147 Ofu-Mir-92-o148 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000005.1: 11521892-11521952 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o149) |
Mir-92-o147
CAIIXF020000005.1: 11520986-11521044 [+]
Mir-92-o148 CAIIXF020000005.1: 11521559-11521617 [+] Mir-92-o149 CAIIXF020000005.1: 11521892-11521952 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
GCUUUUACCUGGUUUCUAGUUGGGGUCUGUAGGCCUUGACAGGUUGCAAUAUUUGUAUUUUUGUAAUCAAAUUGCACUUGUCCCGGCCUGCCUGCUGCAAUCUUUGCUACCAACAUAAACUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 GCUUUUACCUGGUUUCUA--| G CU UU U AUUUGUAUU GUUG GGU GUAGGCC GACAGGU GCAAU U UAAC UCG CGUCCGG CUGUUCA CGUUA U UCAAAUACAACCAUCGUUUC^ G UC CC - AACUAAUGU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending additional data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ofu-Mir-92-o149_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGCCUUGACAGGUUGCAAUAUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ofu-Mir-92-o149_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
39- AAUUGCACUUGUCCCGGCCUGC -61
Get sequence
|