MirGeneDB ID | Pmi-Mir-92-o27 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Bat starfish (Patiria miniata) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Pmi-Mir-92-o21 Pmi-Mir-92-o22 Pmi-Mir-92-o23 Pmi-Mir-92-o24 Pmi-Mir-92-o25 Pmi-Mir-92-o26 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Asu-Mir-92 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | P. miniata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (Pmin1) |
JH769491.1: 33956-34019 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-92-o27) |
Mir-92-o26
JH769491.1: 32701-32762 [+]
Mir-92-o27 JH769491.1: 33956-34019 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
UUACUUAGUACCUCUUUGUCUGCCUUGCGCAGGCCUGGGCCUGUGCAAUGCUUUGGAUUCACUGUGGUCUAGUAUUGCACUCCCCCCGGCCUUUGGAAGGCAGAUACAUGCAACGUGCUUCAUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 UUACUUAGUACCUCUUU--| G C U CCU UUGGAUUC GUCUGCCUU CG AGGCC GGG GUGCAAUGCU A UAGACGGAA GU UCCGG CCC CACGUUAUGA C AUACUUCGUGCAACGUACA^ G U C CCU UCUGGUGU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Pmi-Mir-92-o27_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGCCUGGGCCUGUGCAAUGCU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Pmi-Mir-92-o27_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
42- UAUUGCACUCCCCCCGGCCUUU -64
Get sequence
|