| MirGeneDB ID | Pmi-Mir-92-o24 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Bat starfish (Patiria miniata) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pmi-mir-92d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pmi-Mir-92-o21 Pmi-Mir-92-o22 Pmi-Mir-92-o23 Pmi-Mir-92-o25 Pmi-Mir-92-o26 Pmi-Mir-92-o27 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Asu-Mir-92 Ava-Mir-92-P24 Cel-Mir-92 Esc-Mir-92 Gsp-Mir-92 Hmi-Mir-92 Isc-Mir-92 Obi-Mir-92 Sme-Mir-92 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | P. miniata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (Pmin1) |
JH772232.1: 11031-11096 [-] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-o24) |
Mir-92-o25
JH772232.1: 9421-9483 [-]
Mir-92-o24 JH772232.1: 11031-11096 [-] Mir-92-o23 JH772232.1: 11838-11900 [-] Mir-92-o22 JH772232.1: 12795-12854 [-] Mir-92-o21 JH772232.1: 21466-21523 [-] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
AGUCCGUCGUUCAUUGGCGCAGUGUUGUUUAGGUCGUGACGUGUACAAUGUUGUGAUUUACGCCCUAAGUCCAAUAUUGCACUCGUCCCGGCCUAGAGAACACGGCCCGAUCGUCAUACGAAUUGCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 AGUCCGUCGUUCAUUGGC--| A G U U A GUGAUUUAC GC GUGUU UUUAGGUCG GACG GU CAAUGUU G CG CACAA AGAUCCGGC CUGC CA GUUAUAA C CGUUAAGCAUACUGCUAGCC^ G G C U C CCUGAAUCC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pmi-Mir-92-o24_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- AGGUCGUGACGUGUACAAUGUU -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pmi-Mir-92-o24_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0032154 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
44- UAUUGCACUCGUCCCGGCCUAG -66
Get sequence
|
