MirGeneDB

MirGeneDB ID

Spu-Mir-92-o13

Family name MIR-92 (all species)
Seed AUUGCAC
Species Purple sea urchin (Strongylocentrotus purpuratus)
MiRBase ID spu-mir-92c
Paralogues Spu-Mir-92-o11  Spu-Mir-92-o12  Spu-Mir-92-o55  Spu-Mir-92-o56  Spu-Mir-92-o57  Spu-Mir-92-o58 
Orthologues Asu-Mir-92  Cel-Mir-92  Isc-Mir-92 
Node of Origin (locus) S. purpuratus
Node of Origin (family) Bilateria
Genome context
(Spur_3.1)
Scaffold391: 442488-442553 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-o13)
Mir-92-o12 Scaffold391: 440806-440873 [+] Ensembl
Mir-92-o13 Scaffold391: 442488-442553 [+] Ensembl
Mir-92-o11 Scaffold391: 442948-443012 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UCUCUCCAUCAUCAGUAGAGGGCAGCAAGCUGGUCGUGAGGAGUUGCAAUUUGUCCACAUGAUAAUAAUCAUCAUAUUGCACUCGUCCCGGCCUGCCUGCUUGCCCUCAAUCUCAGGACCAAUAAA
Get precursor sequence
Structure
        10         20         30        40        50        60   
UCUCUCCAUCAUCAGUA-      -|   A  U     U  G    U     U  UCCACAUGA 
                  GAGGGC AGCA GC GGUCG GA GAGU GCAAU UG         \
                  CUCCCG UCGU CG CCGGC CU CUCA CGUUA AC         U
AAAUAACCAGGACUCUAA      U^   C  U     C  G    -     U  UACUAAUAA 
    120       110       100        90         80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-92 genes were present in the last common ancestor of bilaterians and how the vertebrate Mir-92s relate to the invertebrate Mir-92s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsNo
Tissue expression
 +
32 Bl Eg Ga Ov Pl To To
Star sequence

Spu-Mir-92-o13_5p*

MirBase accessionNone
Sequence
0- UGGUCGUGAGGAGUUGCAAUUUG -23
Get sequence
Mature sequence

Spu-Mir-92-o13_3p

MirBase accessionMIMAT0009664
Sequence
44- UAUUGCACUCGUCCCGGCCUGC -66
Get sequence