| MirGeneDB ID | Ami-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | American alligator (Alligator mississippiensis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ami-Mir-92-P1a Ami-Mir-92-P1c Ami-Mir-92-P1d Ami-Mir-92-P2a | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P2c Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Bta-Mir-92-P2c Cel-Mir-92 Cfa-Mir-92-P2c Cja-Mir-92-P2c Cli-Mir-92-P2c Cmi-Mir-92-P2c Cpi-Mir-92-P2c Cpo-Mir-92-P2c Dno-Mir-92-P2c Dre-Mir-92-P2c Eca-Mir-92-P2c Esc-Mir-92 Ete-Mir-92-P2c Gga-Mir-92-P2c Gja-Mir-92-P2c Gmo-Mir-92-P2c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P2c Isc-Mir-92 Laf-Mir-92-P2c Lch-Mir-92-P2c Loc-Mir-92-P2c Mdo-Mir-92-P2c Mml-Mir-92-P2c Mmr-Mir-92-P2c Mmu-Mir-92-P2c Mun-Mir-92-P2c Neu-Mir-92-P2c Oan-Mir-92-P2c Obi-Mir-92 Ocu-Mir-92-P2c Pab-Mir-92-P2c Pbv-Mir-92-P2c Rno-Mir-92-P2c Sha-Mir-92-P2c Sme-Mir-92 Spt-Mir-92-P2c Sto-Mir-92-P2c Tgu-Mir-92-P2c Xla-Mir-92-P2c3 Xla-Mir-92-P2c4 Xtr-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCF_000281125.3_ASM28112v4_AMI_add) |
NW_017711293.1: 2599564-2599628 [-] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2c) |
Mir-92-P2c
NW_017711293.1: 2599564-2599628 [-]
UCSC
Mir-92-P1c NW_017711293.1: 2599701-2599762 [-] UCSC Mir-19-P2c NW_017711293.1: 2599868-2599927 [-] UCSC Mir-17-P4c NW_017711293.1: 2599995-2600056 [-] UCSC Mir-17-P2c NW_017711293.1: 2600210-2600274 [-] UCSC Mir-17-P1c NW_017711293.1: 2600367-2600425 [-] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCGGGUGGUUAUGCUUUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUUUAGAAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACCGCAGGACCUUCAUCGCUGACAACGUAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCGGGUGGUUAUGCUUU--| U GU CA A GAUUAGUU GUUUUGC GUU CGGGUGGAU CG UGCAAUUUU U CAGGACG CAA GUCUACCUA GC ACGUUAAAA A AUGCAACAGUCGCUACUUC^ C AU UG - AGAGGAAG 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ami-Mir-92-P2c_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ami-Mir-92-P2c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- AAUUGCACGGUAUCCAUCUGUA -65
Get sequence
|
