MirGeneDB

MirGeneDB ID

Rno-Mir-92-P2c

Family name MIR-92 (all species)
Seed AUUGCAC
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-25
Paralogues Rno-Mir-92-P1a  Rno-Mir-92-P1b  Rno-Mir-92-P1c  Rno-Mir-92-P2a  Rno-Mir-92-P2b 
Orthologues Asu-Mir-92  Bta-Mir-92-P2c  Cel-Mir-92  Cfa-Mir-92-P2c  Cpo-Mir-92-P2c  Dno-Mir-92-P2c  Dre-Mir-92-P2c  Ete-Mir-92-P2c  Hsa-Mir-92-P2c  Isc-Mir-92  Mdo-Mir-92-P2c  Mml-Mir-92-P2c  Mmu-Mir-92-P2c  Oan-Mir-92-P2c  Ocu-Mir-92-P2c  Sha-Mir-92-P2c  Xtr-Mir-92-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)
chr12: 19307351-19307410 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P2c)
Mir-92-P2c chr12: 19307351-19307410 [-] UCSC Ensembl
Mir-17-P1c chr12: 19307555-19307615 [-] UCSC Ensembl
Mir-17-P3c chr12: 19307761-19307822 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGACACCCACCGGGACUGGCCAGUGUUGAGAGGCGGAGACACGGGCAAUUGCUGGACGCUGCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCCGGCCCAACACUGCAGAUGUGGGG
Get precursor sequence
Structure
        10          20        30        40         50          
GGACACCCACCGGGACU--|   A UG   AG    G      C  -     U   GGACGC 
                   GGCC G  UUG  AGGC GAGACA GG GCAAU GCU      \
                   CCGG C  GAC  UCUG CUCUGU UC CGUUA CGG      U
GGGGUGUAGACGUCACAAC^   C GU   AG    G      -  A     -   GUCCCG 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-92-P2c_5p*

MirBase accessionMIMAT0004713
Sequence
0- AGGCGGAGACACGGGCAAUUGCU -23
Get sequence
Validated targets microrna.org: MIMAT0004713
TargetScanVert: rno-miR-25-5p
miRDB: MIMAT0004713
Mature sequence

Rno-Mir-92-P2c_3p

MirBase accessionMIMAT0000795
Sequence
38- CAUUGCACUUGUCUCGGUCUGA -60
Get sequence
Validated targets microrna.org: MIMAT0000795
TargetScanVert: rno-miR-25-3p
miRDB: MIMAT0000795