| MirGeneDB ID | Cja-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-92 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | White-tufted-ear marmoset (Callithrix jacchus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Cja-Mir-92-P1a Cja-Mir-92-P1c Cja-Mir-92-P1d Cja-Mir-92-P2a Cja-Mir-92-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-92-P2c Ami-Mir-92-P2c Asu-Mir-92 Bfl-Mir-92-o2 Bla-Mir-92-o2 Bta-Mir-92-P2c Cel-Mir-92 Cfa-Mir-92-P2c Cli-Mir-92-P2c Cmi-Mir-92-P2c Cpi-Mir-92-P2c Cpo-Mir-92-P2c Dno-Mir-92-P2c Dre-Mir-92-P2c Eca-Mir-92-P2c Esc-Mir-92 Ete-Mir-92-P2c Gga-Mir-92-P2c Gja-Mir-92-P2c Gmo-Mir-92-P2c Gsp-Mir-92 Hmi-Mir-92 Hsa-Mir-92-P2c Isc-Mir-92 Laf-Mir-92-P2c Lch-Mir-92-P2c Loc-Mir-92-P2c Mdo-Mir-92-P2c Mml-Mir-92-P2c Mmr-Mir-92-P2c Mmu-Mir-92-P2c Mun-Mir-92-P2c Neu-Mir-92-P2c Oan-Mir-92-P2c Obi-Mir-92 Ocu-Mir-92-P2c Pab-Mir-92-P2c Pbv-Mir-92-P2c Rno-Mir-92-P2c Sha-Mir-92-P2c Sme-Mir-92 Spt-Mir-92-P2c Sto-Mir-92-P2c Tgu-Mir-92-P2c Xla-Mir-92-P2c3 Xla-Mir-92-P2c4 Xtr-Mir-92-P2c | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Bilateria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_011100555.2_mCalJa1.2.pat.X_genomic) |
CM021937.1: 125646347-125646411 [-] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-92-P2c) |
Mir-92-P2c
CM021937.1: 125646347-125646411 [-]
UCSC
Ensembl
Mir-92-P1c CM021937.1: 125646508-125646568 [-] UCSC Ensembl Mir-19-P2c CM021937.1: 125646648-125646713 [-] UCSC Ensembl Mir-17-P4c CM021937.1: 125646777-125646837 [-] UCSC Ensembl Mir-17-P2c CM021937.1: 125647007-125647071 [-] UCSC Ensembl Mir-17-P1c CM021937.1: 125647173-125647231 [-] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUUGCAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GCAUUGUAAAAUGAUCUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUAUCAUAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACCGCAGGACCUUUGUUGGCGACAUUCCUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GCAUUGUAAAAUGAUCU--| U GU CA A GAUUAGUA GUUUUGC GUU CGGGUGGAU CG UGCAAUUUU U CAGGACG CAA GUCUACCUA GC ACGUUAAAA C UCCUUACAGCGGUUGUUUC^ C AU UG - AGAGGAUA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | The 3' terminus of the 3p arm might be monoadenylated. The fold pattern in mirMiner would imply that the 3' end of the 3p arm is 1 nt too long; when folded by mFold, the 3' end is the correct length. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Cja-Mir-92-P2c_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Cja-Mir-92-P2c_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
43- AAUUGCACGGUAUCCAUCUGUA -65
Get sequence
|
